ZFIN ID: ZDB-MRPHLNO-130726-1
Morpholino Name: MO1-kcnj10a
Target: kcnj10a (1)
Sequence:
5' - AGGGATAGGAGAGAGATGTTCATTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-kcnj10a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-kcnj10a No data available
PHENOTYPE
Phenotype resulting from MO1-kcnj10a
Phenotype Figures
eye movement quality, abnormal Fig. 3 with image from Mahmood et al., 2013
locomotory behavior process quality, abnormal Fig. 3 with image from Mahmood et al., 2013
mandibular arch skeleton movement quality, abnormal Fig. 3 with image from Mahmood et al., 2013
pericardium edematous, abnormal Fig. 4 with image from Mahmood et al., 2013
pronephric duct dilated, abnormal Fig. 4 with image from Mahmood et al., 2013
pronephros decreased functionality, abnormal Fig. 4 with image from Mahmood et al., 2013
renal system process disrupted, abnormal Fig. 4 with image from Mahmood et al., 2013
swim bladder absent, abnormal Fig. 4 with image from Mahmood et al., 2013
thigmotaxis disrupted, abnormal Fig. 3 with image from Mahmood et al., 2013
whole organism increased contractility, abnormal Fig. 3 with image from Mahmood et al., 2013
Fig. 1 with imageFig. 2 with image from Zdebik et al., 2013
whole organism movement behavioral quality, abnormal Fig. 2 with image from Zdebik et al., 2013

Phenotype of all Fish created by or utilizing MO1-kcnj10a
Phenotype Fish Conditions Figures
swim bladder absent, abnormal TL + MO1-kcnj10a standard conditions Fig. 4 with image from Mahmood et al., 2013
whole organism movement behavioral quality, abnormal TL + MO1-kcnj10a standard conditions Fig. 2 with image from Zdebik et al., 2013
pericardium edematous, abnormal TL + MO1-kcnj10a standard conditions Fig. 4 with image from Mahmood et al., 2013
renal system process disrupted, abnormal TL + MO1-kcnj10a standard conditions Fig. 4 with image from Mahmood et al., 2013
mandibular arch skeleton movement quality, abnormal TL + MO1-kcnj10a standard conditions Fig. 3 with image from Mahmood et al., 2013
pronephros decreased functionality, abnormal TL + MO1-kcnj10a standard conditions Fig. 4 with image from Mahmood et al., 2013
eye movement quality, abnormal TL + MO1-kcnj10a standard conditions Fig. 3 with image from Mahmood et al., 2013
locomotory behavior process quality, abnormal TL + MO1-kcnj10a standard conditions Fig. 3 with image from Mahmood et al., 2013
thigmotaxis disrupted, abnormal TL + MO1-kcnj10a standard conditions Fig. 3 with image from Mahmood et al., 2013
pronephric duct dilated, abnormal TL + MO1-kcnj10a standard conditions Fig. 4 with image from Mahmood et al., 2013
whole organism increased contractility, abnormal TL + MO1-kcnj10a standard conditions Fig. 3 with image from Mahmood et al., 2013
Fig. 1 with imageFig. 2 with image from Zdebik et al., 2013
OTHER MO1-kcnj10a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)