Morpholino

MO3-cobl

ID
ZDB-MRPHLNO-130522-4
Name
MO3-cobl
Previous Names
  • cobl_i3e4 (1)
Target
Sequence
5' - ATCCATCAGAGCTTTTCTGAAGAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cobl
No data available
Phenotype
Phenotype resulting from MO3-cobl
Phenotype of all Fish created by or utilizing MO3-cobl
Phenotype Fish Conditions Figures
head decreased size, abnormal AB + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
whole organism increased curvature, abnormal AB + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
swimming behavior process quality, abnormal AB + MO3-cobl standard conditions Fig. 3 with image from Schuler et al., 2013
neuromuscular process controlling balance process quality, abnormal AB + MO3-cobl standard conditions Fig. 3 with image from Schuler et al., 2013
brain edematous, abnormal AB + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
posterior lateral line neuromast stereocilium decreased length, abnormal AB + MO3-cobl standard conditions Fig. 6 with image from Schuler et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast kinocilium, abnormal AB + MO3-cobl standard conditions Fig. 6 with image from Schuler et al., 2013
eye decreased size, abnormal AB + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
heart edematous, abnormal AB + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
posterior lateral line neuromast decreased amount, abnormal AB + MO3-cobl standard conditions Fig. 4 with image from Schuler et al., 2013
posterior lateral line neuromast kinocilium decreased length, abnormal AB + MO3-cobl standard conditions Fig. 6 with image from Schuler et al., 2013
axis decreased length, abnormal AB + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
somitogenesis decreased process quality, abnormal AB + MO2-pacsin1b + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
brain necrotic, abnormal AB + MO2-pacsin1b + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
brain edematous, abnormal AB + MO2-pacsin1b + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
heart edematous, abnormal AB + MO2-pacsin1b + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
brain unstructured, abnormal AB + MO2-pacsin1b + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
axis decreased length, abnormal AB + MO2-pacsin1b + MO3-cobl standard conditions Fig. 2 with image from Schuler et al., 2013
Citations