Morpholino

MO2-pacsin1b

ID

ZDB-MRPHLNO-130522-3

Name

MO2-pacsin1b

Previous Names

sdpI_ATG (1)

Target

pacsin1b (1)

Sequence

5' - CGTAGGCACCCGACATGCTGAGAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-pacsin1b

Expressed Gene	Anatomy	Figures
eya1	neuromast	Fig. 4 from Schuler et al., 2013
pitx2	lateral plate mesoderm right side	Fig. 2 from Schuler et al., 2013

Phenotype

Phenotype resulting from MO2-pacsin1b

Phenotype	Fish	Figures
axis decreased length, abnormal	AB + MO2-pacsin1b	Fig. 2 from Schuler et al., 2013
brain edematous, abnormal	AB + MO2-pacsin1b	Fig. 2 from Schuler et al., 2013
eye decreased size, abnormal	AB + MO2-pacsin1b	Fig. 2 from Schuler et al., 2013
head decreased size, abnormal	AB + MO2-pacsin1b	Fig. 2 from Schuler et al., 2013
heart edematous, abnormal	AB + MO2-pacsin1b	Fig. 2 from Schuler et al., 2013
neuromuscular process controlling balance process quality, abnormal	AB + MO2-pacsin1b	Fig. 3 from Schuler et al., 2013
posterior lateral line neuromast decreased amount, abnormal	AB + MO2-pacsin1b	Fig. 4 from Schuler et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast kinocilium, abnormal	AB + MO2-pacsin1b	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast kinocilium decreased length, abnormal	AB + MO2-pacsin1b	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast stereocilium decreased length, abnormal	AB + MO2-pacsin1b	Fig. 6 from Schuler et al., 2013
swimming behavior process quality, abnormal	AB + MO2-pacsin1b	Fig. 3 from Schuler et al., 2013
whole organism increased curvature, abnormal	AB + MO2-pacsin1b	Fig. 2 from Schuler et al., 2013

Phenotype of all Fish created by or utilizing MO2-pacsin1b

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
swimming behavior process quality, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 3 from Schuler et al., 2013
whole organism increased curvature, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
posterior lateral line neuromast kinocilium decreased length, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 6 from Schuler et al., 2013
axis decreased length, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
posterior lateral line neuromast decreased amount, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 4 from Schuler et al., 2013
heart edematous, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
head decreased size, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
brain edematous, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast kinocilium, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast stereocilium decreased length, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 6 from Schuler et al., 2013
neuromuscular process controlling balance process quality, abnormal	AB + MO2-pacsin1b	standard conditions	Fig. 3 from Schuler et al., 2013
somitogenesis decreased process quality, abnormal	AB + MO2-pacsin1b + MO3-cobl	standard conditions	Fig. 2 from Schuler et al., 2013
brain necrotic, abnormal	AB + MO2-pacsin1b + MO3-cobl	standard conditions	Fig. 2 from Schuler et al., 2013
brain edematous, abnormal	AB + MO2-pacsin1b + MO3-cobl	standard conditions	Fig. 2 from Schuler et al., 2013
heart edematous, abnormal	AB + MO2-pacsin1b + MO3-cobl	standard conditions	Fig. 2 from Schuler et al., 2013
brain unstructured, abnormal	AB + MO2-pacsin1b + MO3-cobl	standard conditions	Fig. 2 from Schuler et al., 2013
axis decreased length, abnormal	AB + MO2-pacsin1b + MO3-cobl	standard conditions	Fig. 2 from Schuler et al., 2013

Citations