Morpholino

MO6-sox19b

ID
ZDB-MRPHLNO-120221-2
Name
MO6-sox19b
Previous Names
  • Tb (1)
Target
Sequence
5' - TACATCATGCCACTTCTCGCTTTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-sox19b
No data available
Phenotype
Phenotype resulting from MO6-sox19b
Phenotype Fish Figures
axis decreased length, abnormal WT + MO6-sox19b Fig. 2 with imageFig. 5 with image from Li et al., 2019
caudal fin curved dorsal, abnormal WT + MO6-sox19b Fig. 2 with imageFig. 5 with image from Li et al., 2019
diencephalon decreased size, abnormal WT + MO6-sox19b Fig. 2 with image from Li et al., 2019
forebrain ventricle distended, abnormal WT + MO6-sox19b Fig. 3 with image from Li et al., 2019
head decreased size, abnormal WT + MO6-sox19b Fig. 2 with imageFig. 5 with image from Li et al., 2019
head increased size, abnormal AB + MO6-sox19b Fig. 2 from Hu et al., 2011
head morphology, abnormal WT + MO6-sox19b Fig. 2 with imageFig. 5 with image from Li et al., 2019
neural plate isl1a expression increased distribution, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
neural plate neurog1 expression increased distribution, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
neural plate elavl3 expression increased distribution, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
neural plate cell Ab36-h3 labeling absent, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
neuroectoderm pax2a expression decreased distribution, abnormal WT + MO6-sox19b Fig. 2 with image from Li et al., 2019
neuroectoderm anterior region otx2b expression decreased distribution, abnormal WT + MO6-sox19b Fig. 2 with image from Li et al., 2019
notochord morphology, abnormal WT + MO6-sox19b Fig. 3 with image from Li et al., 2019
post-vent region absent, abnormal AB + MO6-sox19b Fig. 2 from Hu et al., 2011
post-vent region decreased length, abnormal AB + MO6-sox19b Fig. 2 from Hu et al., 2011
post-vent region kinked, abnormal AB + MO6-sox19b Fig. 2 from Hu et al., 2011
telencephalon decreased size, abnormal WT + MO6-sox19b Fig. 2 with image from Li et al., 2019
thalamus decreased size, abnormal WT + MO6-sox19b Fig. 2 with imageFig. 5 with image from Li et al., 2019
whole organism her3 expression decreased amount, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
whole organism etv1 expression decreased amount, abnormal WT + MO6-sox19b Fig. 5 with image from Li et al., 2019
whole organism ezh2 expression decreased amount, abnormal WT + MO6-sox19b Fig. 7 with image from Li et al., 2019
whole organism fgf3 expression decreased amount, abnormal WT + MO6-sox19b Fig. 5 with image from Li et al., 2019
whole organism ascl1a expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
whole organism cdkn1bb expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
whole organism neurog1 expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with imageFig. 5 with image from Li et al., 2019
whole organism cdkn1ca expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with image from Li et al., 2019
whole organism elavl3 expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with imageFig. 5 with image from Li et al., 2019
whole organism isl1a expression increased amount, abnormal WT + MO6-sox19b Fig. 4 with imageFig. 5 with image from Li et al., 2019
Phenotype of all Fish created by or utilizing MO6-sox19b
Phenotype Fish Conditions Figures
post-vent region absent, abnormal AB + MO6-sox19b standard conditions Fig. 2 from Hu et al., 2011
post-vent region kinked, abnormal AB + MO6-sox19b standard conditions Fig. 2 from Hu et al., 2011
head increased size, abnormal AB + MO6-sox19b standard conditions Fig. 2 from Hu et al., 2011
post-vent region decreased length, abnormal AB + MO6-sox19b standard conditions Fig. 2 from Hu et al., 2011
neuroectoderm pax2a expression decreased distribution, abnormal WT + MO6-sox19b standard conditions Fig. 2 with image from Li et al., 2019
head morphology, abnormal WT + MO6-sox19b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2019
whole organism elavl3 expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with imageFig. 5 with image from Li et al., 2019
diencephalon decreased size, abnormal WT + MO6-sox19b standard conditions Fig. 2 with image from Li et al., 2019
thalamus decreased size, abnormal WT + MO6-sox19b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2019
neural plate cell Ab36-h3 labeling absent, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
telencephalon decreased size, abnormal WT + MO6-sox19b standard conditions Fig. 2 with image from Li et al., 2019
whole organism etv1 expression decreased amount, abnormal WT + MO6-sox19b standard conditions Fig. 5 with image from Li et al., 2019
whole organism ascl1a expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
neural plate neurog1 expression increased distribution, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
axis decreased length, abnormal WT + MO6-sox19b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2019
head decreased size, abnormal WT + MO6-sox19b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2019
neural plate elavl3 expression increased distribution, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism cdkn1bb expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism ezh2 expression decreased amount, abnormal WT + MO6-sox19b standard conditions Fig. 7 with image from Li et al., 2019
whole organism fgf3 expression decreased amount, abnormal WT + MO6-sox19b standard conditions Fig. 5 with image from Li et al., 2019
caudal fin curved dorsal, abnormal WT + MO6-sox19b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2019
notochord morphology, abnormal WT + MO6-sox19b standard conditions Fig. 3 with image from Li et al., 2019
neural plate isl1a expression increased distribution, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism her3 expression decreased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
whole organism cdkn1ca expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with image from Li et al., 2019
forebrain ventricle distended, abnormal WT + MO6-sox19b standard conditions Fig. 3 with image from Li et al., 2019
whole organism isl1a expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with imageFig. 5 with image from Li et al., 2019
neuroectoderm anterior region otx2b expression decreased distribution, abnormal WT + MO6-sox19b standard conditions Fig. 2 with image from Li et al., 2019
whole organism neurog1 expression increased amount, abnormal WT + MO6-sox19b standard conditions Fig. 4 with imageFig. 5 with image from Li et al., 2019
Citations