Morpholino

MO3-eif3ha

ID
ZDB-MRPHLNO-120207-10
Name
MO3-eif3ha
Previous Names
None
Target
Sequence
5' - GGAGATTGCCGTGCGCCTCACCTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-eif3ha
No data available
Phenotype
Phenotype resulting from MO3-eif3ha
Phenotype Fish Figures
brain degenerate, abnormal AB/TU + MO3-eif3ha Fig. 5 with image from Choudhuri et al., 2010
brain development disrupted, abnormal AB/TU + MO3-eif3ha Fig. 5 with image from Choudhuri et al., 2010
intersegmental vessel spatial pattern, abnormal y1Tg + MO3-eif3ha Fig. 9 with image from Choudhuri et al., 2010
posterior lateral line neuromast decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 8 with image from Choudhuri et al., 2010
vasculature development disrupted, abnormal y1Tg + MO3-eif3ha Fig. 9 with image from Choudhuri et al., 2010
whole organism ribosome slc25a4 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d21 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome fgl1 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome and3 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome bscl2l expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome slc18a3b expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d9 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d8 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome pvalb1 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d13 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d10 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d17 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d19 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome mipb expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d11 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d12 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 4 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d18 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygmxl2 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome atp2a1l expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome cox4i1l expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome hspb2 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome si:dkey-17e16.15 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d4 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 4 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d5 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome cryba1l2 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d2 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d3 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 4 with image from Choudhuri et al., 2013
whole organism ribosome and2 expression decreased amount, abnormal AB/TU + MO3-eif3ha Fig. 2 with image from Choudhuri et al., 2013
Phenotype of all Fish created by or utilizing MO3-eif3ha
Phenotype Fish Conditions Figures
whole organism ribosome bscl2l expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d2 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d5 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome and2 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d8 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d18 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome fgl1 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome mipb expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome slc25a4 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome cox4i1l expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome pvalb1 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d3 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 4 with image from Choudhuri et al., 2013
whole organism ribosome atp2a1l expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d12 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 4 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d21 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d19 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d10 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d4 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 4 with image from Choudhuri et al., 2013
whole organism ribosome si:dkey-17e16.15 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
posterior lateral line neuromast decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 8 with image from Choudhuri et al., 2010
whole organism ribosome crygm2d13 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome cryba1l2 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygmxl2 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
brain degenerate, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 5 with image from Choudhuri et al., 2010
whole organism ribosome crygm2d17 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d11 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome and3 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome crygm2d9 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
brain development disrupted, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 5 with image from Choudhuri et al., 2010
whole organism ribosome hspb2 expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
whole organism ribosome slc18a3b expression decreased amount, abnormal AB/TU + MO3-eif3ha standard conditions Fig. 2 with image from Choudhuri et al., 2013
vasculature development disrupted, abnormal y1Tg + MO3-eif3ha standard conditions Fig. 9 with image from Choudhuri et al., 2010
intersegmental vessel spatial pattern, abnormal y1Tg + MO3-eif3ha standard conditions Fig. 9 with image from Choudhuri et al., 2010
brain degenerate, abnormal AB/TU + MO3-eif3ha + MO3-eif3hb standard conditions Fig. 6 with image from Choudhuri et al., 2010
brain development disrupted, abnormal AB/TU + MO3-eif3ha + MO3-eif3hb standard conditions Fig. 6 with image from Choudhuri et al., 2010
Citations