Morpholino

MO2-def6a

ID
ZDB-MRPHLNO-111207-3
Name
MO2-def6a
Previous Names
  • def6 splice MO (1)
Target
Sequence
5' - AAAGAGAGCATACCTTGTCCAGGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO (exon2/intron2 boundary).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-def6a
No data available
Phenotype
Phenotype resulting from MO2-def6a
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-def6a Fig. 2 with imageFig. 3 with imageFig. 6 with imageFig. 9 with imageFig. S2 with image from Goudevenou et al., 2011
axis elongation disrupted, abnormal WT + MO2-def6a Fig. 2 with image from Goudevenou et al., 2011
brain morphology, abnormal WT + MO2-def6a Fig. 6 with imageFig. 9 with imageFig. S2 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO2-def6a Fig. 2 with imageFig. 6 with imageFig. 9 with image from Goudevenou et al., 2011
cell migration involved in mesendoderm migration disrupted, abnormal WT + MO2-def6a Fig. 4 with image from Goudevenou et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
eye decreased distance eye, abnormal WT + MO2-def6a Fig. 9 with image from Goudevenou et al., 2011
eye increased distance eye, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
forebrain structure, abnormal WT + MO2-def6a Fig. 9 with image from Goudevenou et al., 2011
head anterior region flattened, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
hindbrain neural keel increased width, abnormal WT + MO2-def6a Fig. 4 with image from Goudevenou et al., 2011
Meckel's cartilage decreased length, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
Meckel's cartilage shape, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
midbrain hindbrain boundary neural keel increased width, abnormal WT + MO2-def6a Fig. 4 with image from Goudevenou et al., 2011
neural plate increased width, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
notochord decreased length, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
notochord increased width, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
notochord undulate, abnormal WT + MO2-def6a Fig. 5 with imageFig. S2 with image from Goudevenou et al., 2011
paraxial mesoderm adaxial cell increased distance paraxial mesoderm adaxial cell, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
paraxial mesoderm formation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
pericardium edematous, abnormal WT + MO2-def6a Fig. S2 with image from Goudevenou et al., 2011
polster mislocalised posteriorly, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
segmental plate curved, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
segmental plate increased width, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
somite morphology, abnormal WT + MO2-def6a Fig. 5 with imageFig. 6 with imageFig. S2 with image from Goudevenou et al., 2011
tail bud truncated, abnormal WT + MO2-def6a Fig. 6 with imageFig. S2 with image from Goudevenou et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-def6a Fig. 2 with imageFig. 6 with imageFig. S2 with image from Goudevenou et al., 2011
Phenotype of all Fish created by or utilizing MO2-def6a
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-def6a standard conditions Fig. 2 with imageFig. 6 with imageFig. S2 with image from Goudevenou et al., 2011
paraxial mesoderm formation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 2 with imageFig. 6 with imageFig. 9 with image from Goudevenou et al., 2011
neural plate increased width, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
segmental plate curved, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
segmental plate increased width, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
eye decreased distance eye, abnormal WT + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
hindbrain neural keel increased width, abnormal WT + MO2-def6a standard conditions Fig. 4 with image from Goudevenou et al., 2011
axis decreased length, abnormal WT + MO2-def6a standard conditions Fig. 2 with imageFig. 3 with imageFig. 6 with imageFig. 9 with imageFig. S2 with image from Goudevenou et al., 2011
Meckel's cartilage shape, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
axis elongation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 2 with image from Goudevenou et al., 2011
forebrain structure, abnormal WT + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
eye increased distance eye, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
polster mislocalised posteriorly, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
cell migration involved in mesendoderm migration disrupted, abnormal WT + MO2-def6a standard conditions Fig. 4 with image from Goudevenou et al., 2011
brain morphology, abnormal WT + MO2-def6a standard conditions Fig. 6 with imageFig. 9 with imageFig. S2 with image from Goudevenou et al., 2011
midbrain hindbrain boundary neural keel increased width, abnormal WT + MO2-def6a standard conditions Fig. 4 with image from Goudevenou et al., 2011
paraxial mesoderm adaxial cell increased distance paraxial mesoderm adaxial cell, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
somite morphology, abnormal WT + MO2-def6a standard conditions Fig. 5 with imageFig. 6 with imageFig. S2 with image from Goudevenou et al., 2011
tail bud truncated, abnormal WT + MO2-def6a standard conditions Fig. 6 with imageFig. S2 with image from Goudevenou et al., 2011
notochord decreased length, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
Meckel's cartilage decreased length, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
notochord increased width, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
head anterior region flattened, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
pericardium edematous, abnormal WT + MO2-def6a standard conditions Fig. S2 with image from Goudevenou et al., 2011
notochord undulate, abnormal WT + MO2-def6a standard conditions Fig. 5 with imageFig. S2 with image from Goudevenou et al., 2011
axis decreased length, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
forebrain anterior region aplastic, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
eye fused with eye, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
Citations