Morpholino

MO1-il1b

ID
ZDB-MRPHLNO-110620-2
Name
MO1-il1b
Previous Names
None
Target
Sequence
5' - CCCACAAACTGCAAAATATCAGCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-il1b
No data available
Phenotype
Phenotype resulting from MO1-il1b
Phenotype of all Fish created by or utilizing MO1-il1b
Phenotype Fish Conditions Figures
whole organism decreased life span, exacerbated AB + MO1-il1b bacterial treatment by injection: Burkholderia cenocepacia Fig. 8 with image from Mesureur et al., 2017
fin regeneration decreased efficacy, abnormal WT + MO1-il1b amputation: caudal fin Fig. 7 with image from Hasegawa et al., 2017
regenerating fin decreased length, abnormal WT + MO1-il1b amputation: caudal fin Fig. 7 with image from Hasegawa et al., 2017
caudal fin regenerating fin junba expression decreased amount, abnormal WT + MO1-il1b amputation: caudal fin Fig. 7 with image from Hasegawa et al., 2017
regenerating fin cell population proliferation decreased occurrence, abnormal WT + MO1-il1b amputation: caudal fin Fig. 7 with image from Hasegawa et al., 2017
notochord neutrophil decreased amount, abnormal i114Tg + MO1-il1b bacterial treatment by injection: Escherichia coli K-12 Fig. 7 with image from Nguyen-Chi et al., 2014
notochord neutrophil activation involved in immune response decreased occurrence, abnormal i114Tg + MO1-il1b bacterial treatment by injection: Escherichia coli K-12 Fig. 7 with image from Nguyen-Chi et al., 2014
caudal fin regenerating fin EGFP expression decreased amount, abnormal nkhgn21aEt + MO1-il1b amputation: caudal fin Fig. 7 with image from Hasegawa et al., 2017
macrophage chemotaxis decreased occurrence, abnormal s1999tTg; sh256Tg + MO1-il1b control Fig. S2 from Ogryzko et al., 2014
defense response to bacterium decreased efficacy, abnormal mitfaw2/w2 + MO1-il1b bacterial treatment by injection: Mycobacterium marinum M Fig. 4 from Ogryzko et al., 2018
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-il1b + MO1-irf8 amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-il1b + MO1-spi1b amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
regenerating fin apoptotic process occurrence, ameliorated npas4lDf(Chr13:lycat)m39/m39 + MO1-il1b amputation: caudal fin Fig. 3 with image from Hasegawa et al., 2017
Citations