ZFIN ID: ZDB-MRPHLNO-110118-3
Morpholino Name: MO3-cdc14b
Target: cdc14b (1)
Previous Name: MORPH1735 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTGCAGCAGAAGCGGTACAGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cdc14b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cdc14b No data available
PHENOTYPE
Phenotype resulting from MO3-cdc14b
Phenotype of all Fish created by or utilizing MO3-cdc14b
Phenotype Fish Conditions Figures
pronephric duct cilium decreased length, abnormal WT + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 4 with image from Clément et al., 2011
post-vent region curved ventral, abnormal WT + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
pericardium edematous, abnormal WT + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
pronephric duct cilium decreased amount, abnormal WT + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 4 with image from Clément et al., 2011
brain hydrocephalic, abnormal WT + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
pronephric duct cilium decreased amount, abnormal WT + MO3-cdc14b standard conditions Fig. 4 with image from Clément et al., 2011
pronephric duct cilium increased length, abnormal WT + MO3-cdc14b standard conditions Fig. 4 with image from Clément et al., 2011
post-vent region curved ventral, abnormal WT + MO3-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
pericardium edematous, abnormal WT + MO3-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
brain hydrocephalic, abnormal WT + MO3-cdc14b standard conditions Fig. 1 with image from Clément et al., 2011
Kupffer's vesicle cilium increased amount, abnormal s870Tg + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 3 with image from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO2-cdc14b + MO3-cdc14b standard conditions Fig. 3 with image from Clément et al., 2011
Kupffer's vesicle cilium increased amount, abnormal s870Tg + MO3-cdc14b standard conditions Fig. 3 with image from Clément et al., 2011
Genome Resources:
CITATIONS (1)