Morpholino

MO1-dpysl3

ID
ZDB-MRPHLNO-110107-1
Name
MO1-dpysl3
Previous Names
None
Target
Sequence
5' - TCTTTTTGCCTTGGTAAGACATGGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dpysl3
No data available
Phenotype
Phenotype resulting from MO1-dpysl3
Phenotype Fish Figures
anterior commissure axon decreased distribution, abnormal RW + MO1-dpysl3 Fig. 1 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO1-dpysl3 Fig. 1 from Guo et al., 2022
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal WT + MO1-dpysl3 Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
postoptic commissure axon decreased distribution, abnormal RW + MO1-dpysl3 Fig. 1 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO1-dpysl3 Fig. 1 from Guo et al., 2022
retinal neural layer axon mislocalised, abnormal WT + MO1-dpysl3 Fig. 3 with image from Liu et al., 2018
retinal neural layer axon guidance disrupted, abnormal WT + MO1-dpysl3 Fig. 3 with image from Liu et al., 2018
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-dpysl3 Fig. 1 with image from Tanaka et al., 2012
Rohon-Beard neuron axon decreased amount, abnormal WT + MO1-dpysl3 Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
Phenotype of all Fish created by or utilizing MO1-dpysl3
Phenotype Fish Conditions Figures
anterior commissure axon decreased distribution, abnormal RW + MO1-dpysl3 control Fig. 1 from Guo et al., 2022
postoptic commissure axon decreased distribution, abnormal RW + MO1-dpysl3 control Fig. 1 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO1-dpysl3 control Fig. 1 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO1-dpysl3 control Fig. 1 from Guo et al., 2022
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal WT + MO1-dpysl3 standard conditions Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
retinal neural layer axon mislocalised, abnormal WT + MO1-dpysl3 standard conditions Fig. 3 with image from Liu et al., 2018
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-dpysl3 standard conditions Fig. 1 with image from Tanaka et al., 2012
retinal neural layer axon guidance disrupted, abnormal WT + MO1-dpysl3 standard conditions Fig. 3 with image from Liu et al., 2018
Rohon-Beard neuron axon decreased amount, abnormal WT + MO1-dpysl3 standard conditions Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
CaP motoneuron mislocalised, abnormal RW + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 2 from Morimura et al., 2013
retinal neural layer axon mislocalised, abnormal WT + MO1-dpysl3 + MO2-nrp1a standard conditions Fig. 4 with image from Liu et al., 2018
retinal neural layer axon guidance disrupted, abnormal WT + MO1-dpysl3 + MO2-nrp1a standard conditions Fig. 4 with image from Liu et al., 2018
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal WT + MO1-dpysl3 + MO2-sema3d standard conditions Fig. 9 with image from Tanaka et al., 2011
Rohon-Beard neuron axon decreased amount, abnormal WT + MO1-dpysl3 + MO2-sema3d standard conditions Fig. 9 with image from Tanaka et al., 2011
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 1 with image,  Fig. 9 with image from Tanaka et al., 2012
retinal neural layer axon truncated, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 5 with image from Liu et al., 2018
neural crest cell displaced to spinal cord lateral margin, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 10 with image from Tanaka et al., 2012
retinal neural layer axon decreased branchiness, abnormal WT + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 5 with image from Liu et al., 2018
Rohon-Beard neuron displaced to spinal cord axis, abnormal rw011bTg + MO1-dpysl3 + MO3-dpysl2b standard conditions Fig. 7 with image from Tanaka et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.