Morpholino

MO1-wls

ID
ZDB-MRPHLNO-101011-2
Name
MO1-wls
Previous Names
None
Target
Sequence
5' - CTCAATAATTGCCCCAGCCATTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wls
No data available
Phenotype
Phenotype resulting from MO1-wls
Phenotype Fish Figures
brain disorganized, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
brain malformed, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
brain development disrupted, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
ceratobranchial cartilage malformed, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
ceratohyal cartilage decreased size, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
ceratohyal cartilage dislocated, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal AB + MO1-wls Fig. 2 with imageFig. 3 with image from Wu et al., 2015
eye decreased size, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
head decreased size, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
inner ear malformed, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
Meckel's cartilage dislocated, abnormal AB + MO1-wls Fig. 2 with image from Wu et al., 2015
midbrain hindbrain boundary aplastic, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
midbrain hindbrain boundary poorly differentiated, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
otic vesicle decreased size, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
pharyngeal arch cartilage development decreased process quality, abnormal AB + MO1-wls Fig. 7 with image from Wu et al., 2015
pharyngeal arch cell population proliferation decreased occurrence, abnormal AB + MO1-wls Fig. 7 with image from Wu et al., 2015
pharyngeal arch Wnt protein secretion decreased occurrence, abnormal AB + MO1-wls Fig. 4 with image from Wu et al., 2015
pharyngeal pouch 1 decreased object quality, abnormal AB + MO1-wls Fig. 3 with image from Wu et al., 2015
pharyngeal pouch 2 decreased object quality, abnormal AB + MO1-wls Fig. 3 with image from Wu et al., 2015
post-vent region curved lateral, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
post-vent region curved ventral, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
semicircular canal morphology, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
semicircular canal development disrupted, abnormal WT + MO1-wls Fig. 4 with image from Jin et al., 2010
Phenotype of all Fish created by or utilizing MO1-wls
Phenotype Fish Conditions Figures
inner ear malformed, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
brain malformed, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
pharyngeal arch cell population proliferation decreased occurrence, abnormal AB + MO1-wls standard conditions Fig. 7 with image from Wu et al., 2015
pharyngeal arch Wnt protein secretion decreased occurrence, abnormal AB + MO1-wls standard conditions Fig. 4 with image from Wu et al., 2015
pharyngeal pouch 2 decreased object quality, abnormal AB + MO1-wls standard conditions Fig. 3 with image from Wu et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal AB + MO1-wls standard conditions Fig. 2 with imageFig. 3 with image from Wu et al., 2015
ceratobranchial cartilage malformed, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
pharyngeal arch cartilage development decreased process quality, abnormal AB + MO1-wls standard conditions Fig. 7 with image from Wu et al., 2015
ceratohyal cartilage dislocated, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
pharyngeal pouch 1 decreased object quality, abnormal AB + MO1-wls standard conditions Fig. 3 with image from Wu et al., 2015
Meckel's cartilage dislocated, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
ceratohyal cartilage decreased size, abnormal AB + MO1-wls standard conditions Fig. 2 with image from Wu et al., 2015
brain disorganized, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
semicircular canal development disrupted, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
brain development disrupted, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
midbrain hindbrain boundary poorly differentiated, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
post-vent region curved ventral, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
otic vesicle decreased size, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
head decreased size, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
post-vent region curved lateral, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
semicircular canal morphology, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
midbrain hindbrain boundary aplastic, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
eye decreased size, abnormal WT + MO1-wls standard conditions Fig. 4 with image from Jin et al., 2010
Citations