Morpholino

MO3-cdk9

ID
ZDB-MRPHLNO-100728-5
Name
MO3-cdk9
Previous Names
  • Cdk9 e3/i3 MO (1)
Target
Sequence
5' - GGTGCATTTTCTTACCCCTTCTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cdk9
Expressed Gene Anatomy Figures
cdk9 Fig. 2 from Matrone et al., 2015
gata6 Fig. 6 from Matrone et al., 2015
hbbe3 Fig. 5 with image from Bai et al., 2010
Phenotype
Phenotype resulting from MO3-cdk9
Phenotype Fish Figures
brain apoptotic body increased amount, abnormal WIK + MO3-cdk9 Fig. 3 with image from Matrone et al., 2016
cardiac muscle cell decreased amount, abnormal f1Tg + MO3-cdk9 Fig. 7 from Matrone et al., 2015
cardiac muscle contraction process quality, abnormal f1Tg + MO3-cdk9 Fig. 3 with image,  Fig. 7,  Fig. 8 with image from Matrone et al., 2015
cardiac muscle tissue regeneration decreased occurrence, abnormal f1Tg + MO3-cdk9 Fig. 8 with image from Matrone et al., 2015
cardiac ventricle decreased size, abnormal f1Tg + MO3-cdk9 Fig. 3 with image from Matrone et al., 2015
cardiac ventricle cardiac muscle cell decreased amount, abnormal f1Tg + MO3-cdk9 Fig. 5 with image from Matrone et al., 2015
erythrocyte differentiation decreased occurrence, abnormal WT + MO3-cdk9 Fig. 5 with image from Bai et al., 2010
eye decreased size, abnormal WIK + MO3-cdk9 Fig. 3 with image from Matrone et al., 2016
forebrain hypoplastic, abnormal WIK + MO3-cdk9 Fig. 3 with image from Matrone et al., 2016
heart decreased size, abnormal f1Tg + MO3-cdk9 Fig. 3 with image from Matrone et al., 2015
heart morphology, abnormal f1Tg + MO3-cdk9 Fig. 3 with image,  Fig. 8 with image from Matrone et al., 2015
midbrain hypoplastic, abnormal WIK + MO3-cdk9 Fig. 3 with image from Matrone et al., 2016
pericardium edematous, abnormal WIK + MO3-cdk9 Fig. 2 with image from Matrone et al., 2016
trunk curved, abnormal WIK + MO3-cdk9 Fig. 2 with image from Matrone et al., 2016
trunk apoptotic process increased occurrence, abnormal WIK + MO3-cdk9 Fig. 4 with image from Matrone et al., 2016
trunk cell population proliferation decreased occurrence, abnormal WIK + MO3-cdk9 Fig. 5 with image from Matrone et al., 2016
whole organism gata6 expression decreased amount, abnormal f1Tg + MO3-cdk9 Fig. 6 from Matrone et al., 2015
whole organism ab3-cdk9 labeling decreased amount, abnormal f1Tg + MO3-cdk9 Fig. 2 from Matrone et al., 2015
whole organism cdk9 expression decreased amount, abnormal f1Tg + MO3-cdk9 Fig. 2 from Matrone et al., 2015
whole organism decreased life span, abnormal WIK + MO3-cdk9 Fig. 1 from Matrone et al., 2016
whole organism malformed, abnormal WIK + MO3-cdk9 Fig. 2 with image from Matrone et al., 2016
whole organism morphology, abnormal f1Tg + MO3-cdk9 Fig. 8 with image from Matrone et al., 2015
Phenotype of all Fish created by or utilizing MO3-cdk9
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WIK + MO3-cdk9 standard conditions Fig. 2 with image from Matrone et al., 2016
trunk cell population proliferation decreased occurrence, abnormal WIK + MO3-cdk9 standard conditions Fig. 5 with image from Matrone et al., 2016
forebrain hypoplastic, abnormal WIK + MO3-cdk9 standard conditions Fig. 3 with image from Matrone et al., 2016
whole organism decreased life span, abnormal WIK + MO3-cdk9 standard conditions Fig. 1 from Matrone et al., 2016
trunk curved, abnormal WIK + MO3-cdk9 standard conditions Fig. 2 with image from Matrone et al., 2016
eye decreased size, abnormal WIK + MO3-cdk9 standard conditions Fig. 3 with image from Matrone et al., 2016
midbrain hypoplastic, abnormal WIK + MO3-cdk9 standard conditions Fig. 3 with image from Matrone et al., 2016
brain apoptotic body increased amount, abnormal WIK + MO3-cdk9 standard conditions Fig. 3 with image from Matrone et al., 2016
whole organism malformed, abnormal WIK + MO3-cdk9 standard conditions Fig. 2 with image from Matrone et al., 2016
trunk apoptotic process increased occurrence, abnormal WIK + MO3-cdk9 standard conditions Fig. 4 with image from Matrone et al., 2016
erythrocyte differentiation decreased occurrence, abnormal WT + MO3-cdk9 standard conditions Fig. 5 with image from Bai et al., 2010
heart decreased size, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 3 with image from Matrone et al., 2015
whole organism gata6 expression decreased amount, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 6 from Matrone et al., 2015
cardiac muscle cell decreased amount, abnormal f1Tg + MO3-cdk9 surgical manipulation: cardiac ventricle Fig. 7 from Matrone et al., 2015
cardiac ventricle decreased size, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 3 with image from Matrone et al., 2015
cardiac muscle cell decreased amount, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 7 from Matrone et al., 2015
whole organism ab3-cdk9 labeling decreased amount, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 2 from Matrone et al., 2015
cardiac ventricle cardiac muscle cell decreased amount, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 5 with image from Matrone et al., 2015
heart morphology, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 3 with image,  Fig. 8 with image from Matrone et al., 2015
whole organism morphology, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 8 with image from Matrone et al., 2015
cardiac muscle contraction process quality, abnormal f1Tg + MO3-cdk9 surgical manipulation: cardiac ventricle Fig. 7 from Matrone et al., 2015
cardiac muscle contraction process quality, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 3 with image,  Fig. 7,  Fig. 8 with image from Matrone et al., 2015
cardiac muscle tissue regeneration decreased occurrence, abnormal f1Tg + MO3-cdk9 surgical manipulation: cardiac ventricle Fig. 7 from Matrone et al., 2015
whole organism cdk9 expression decreased amount, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 2 from Matrone et al., 2015
cardiac muscle tissue regeneration decreased occurrence, abnormal f1Tg + MO3-cdk9 standard conditions Fig. 8 with image from Matrone et al., 2015
regenerating fin macrophage decreased amount, abnormal gl23Tg + MO3-cdk9 transection: caudal fin Fig. 6 with image from Hoodless et al., 2016
regenerating fin neutrophil decreased amount, abnormal i114Tg + MO3-cdk9 transection: caudal fin Fig. 4 with image from Hoodless et al., 2016
neutrophil apoptotic process increased occurrence, abnormal i114Tg + MO3-cdk9 transection: caudal fin Fig. 4 with image from Hoodless et al., 2016
whole organism morphology, ameliorated f1Tg + MO2-larp7 + MO3-cdk9 standard conditions Fig. 8 with image from Matrone et al., 2015
cardiac muscle tissue regeneration occurrence, ameliorated f1Tg + MO2-larp7 + MO3-cdk9 standard conditions Fig. 8 with image from Matrone et al., 2015
heart morphology, ameliorated f1Tg + MO2-larp7 + MO3-cdk9 standard conditions Fig. 8 with image from Matrone et al., 2015
cardiac muscle contraction process quality, ameliorated f1Tg + MO2-larp7 + MO3-cdk9 standard conditions Fig. 8 with image from Matrone et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.