Morpholino
MO3-cdk9
- ID
- ZDB-MRPHLNO-100728-5
- Name
- MO3-cdk9
- Previous Names
-
- Cdk9 e3/i3 MO (1)
- Target
- Sequence
-
5' - GGTGCATTTTCTTACCCCTTCTTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cdk9
Expressed Gene | Anatomy | Figures |
---|---|---|
cdk9 |
Fig. 2
from Matrone et al., 2015 |
|
gata6 |
Fig. 6
from Matrone et al., 2015 |
|
hbbe3 |
Fig. 5 ![]() |
1 - 3 of 3
Phenotype
Phenotype resulting from MO3-cdk9
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO3-cdk9
1 - 5 of 32 Show all
Citations
- Jurynec, M.J., Bai, X., Bisgrove, B.W., Jackson, H., Nechiporuk, A., Palu, R.A.S., Grunwald, H.A., Su, Y.C., Hoshijima, K., Yost, H.J., Zon, L.I., Grunwald, D.J. (2019) The Paf1 Complex and P-TEFb have reciprocal and antagonist roles in maintaining multipotent neural crest progenitors. Development (Cambridge, England). 146(24):
- Hoodless, L.J., Lucas, C.D., Duffin, R., Denvir, M.A., Haslett, C., Tucker, C.S., Rossi, A.G. (2016) Genetic and pharmacological inhibition of CDK9 drives neutrophil apoptosis to resolve inflammation in zebrafish in vivo. Scientific Reports. 5:36980
- Matrone, G., Mullins, J.J., Tucker, C.S., Denvir, M.A. (2016) Effects of Cyclin Dependent Kinase 9 inhibition on zebrafish larvae. Cell cycle (Georgetown, Tex.). 15(22):3060-3069
- Matrone, G., Wilson, K.S., Maqsood, S., Mullins, J.J., Tucker, C.S., Denvir, M.A. (2015) CDK9 and its repressor LARP7 modulate cardiomyocyte proliferation and response to injury in the zebrafish heart. Journal of Cell Science. 128(24):4560-71
- Bai, X., Kim, J., Yang, Z., Jurynec, M.J., Akie, T.E., Lee, J., LeBlanc, J., Sessa, A., Jiang, H., DiBiase, A., Zhou, Y., Grunwald, D.J., Lin, S., Cantor, A.B., Orkin, S.H., and Zon, L.I. (2010) TIF1gamma controls erythroid cell fate by regulating transcription elongation. Cell. 142(1):133-143
1 - 5 of 5
Show