Morpholino

MO1-atoh7

ID
ZDB-MRPHLNO-100405-2
Name
MO1-atoh7
Previous Names
  • ath5MO (1)
Target
Sequence
5' - TTCATGGCTCTTCAAAAAAGTCTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atoh7
No data available
Phenotype
Phenotype resulting from MO1-atoh7
Phenotype Fish Figures
amacrine cell increased amount, abnormal cu2Tg + MO1-atoh7 Fig. 5 with image from Almeida et al., 2014
eye photoreceptor cell increased amount, abnormal cu2Tg + MO1-atoh7 Fig. 5 with image from Almeida et al., 2014
retinal bipolar neuron increased amount, abnormal cu2Tg + MO1-atoh7 Fig. 5 with image from Almeida et al., 2014
retinal ganglion cell decreased amount, abnormal zc7Tg + MO1-atoh7 Fig. 5 with image from Almeida et al., 2014
Fig. S6 with image from Clark et al., 2012
Fig. 1 with image from Pittman et al., 2008
retinal ganglion cell axon guidance disrupted, abnormal zc7Tg + MO1-atoh7 Fig. 2 with image from Pittman et al., 2008
Phenotype of all Fish created by or utilizing MO1-atoh7
Phenotype Fish Conditions Figures
eye photoreceptor cell increased amount, abnormal cu2Tg + MO1-atoh7 standard conditions Fig. 5 with image from Almeida et al., 2014
retinal ganglion cell decreased amount, abnormal cu2Tg + MO1-atoh7 standard conditions Fig. 5 with image from Almeida et al., 2014
amacrine cell increased amount, abnormal cu2Tg + MO1-atoh7 standard conditions Fig. 5 with image from Almeida et al., 2014
retinal bipolar neuron increased amount, abnormal cu2Tg + MO1-atoh7 standard conditions Fig. 5 with image from Almeida et al., 2014
retinal ganglion cell decreased amount, abnormal s356tTg + MO1-atoh7 standard conditions Fig. S6 with image from Clark et al., 2012
retinal ganglion cell decreased amount, abnormal zc7Tg + MO1-atoh7 standard conditions Fig. 1 with image from Pittman et al., 2008
retinal ganglion cell axon guidance disrupted, abnormal zc7Tg + MO1-atoh7 standard conditions Fig. 2 with image from Pittman et al., 2008
eye photoreceptor cell increased amount, abnormal cu2Tg + MO1-atoh7 + MO1-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
retinal bipolar neuron increased amount, abnormal cu2Tg + MO1-atoh7 + MO1-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
amacrine cell decreased amount, abnormal cu2Tg + MO1-atoh7 + MO1-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
retinal ganglion cell absence of anatomical entity, abnormal cu2Tg + MO1-atoh7 + MO1-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
horizontal cell absence of anatomical entity, abnormal cu2Tg + MO1-atoh7 + MO1-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
eye photoreceptor cell increased amount, abnormal cu2Tg + MO1-atoh7 + MO4-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
retinal bipolar neuron increased amount, abnormal cu2Tg + MO1-atoh7 + MO4-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
amacrine cell decreased amount, abnormal cu2Tg + MO1-atoh7 + MO4-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
retinal ganglion cell absence of anatomical entity, abnormal cu2Tg + MO1-atoh7 + MO4-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
horizontal cell absence of anatomical entity, abnormal cu2Tg + MO1-atoh7 + MO4-ptf1a standard conditions Fig. 5 with image from Almeida et al., 2014
eye photoreceptor cell increased amount, abnormal cu2Tg + MO1-atoh7 + MO4-vsx1 standard conditions Fig. 5 with image from Almeida et al., 2014
amacrine cell increased amount, abnormal cu2Tg + MO1-atoh7 + MO4-vsx1 standard conditions Fig. 5 with image from Almeida et al., 2014
amacrine cell displaced, abnormal cu2Tg + MO1-atoh7 + MO4-vsx1 standard conditions Fig. 5 with image from Almeida et al., 2014
retinal inner plexiform layer YFP expression spatial pattern, abnormal q16aTg; q16bTg; q19Tg + MO1-atoh7 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer Cerulean expression spatial pattern, abnormal q16aTg; q16bTg; q19Tg + MO1-atoh7 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.