Morpholino

MO1-fut8a

ID
ZDB-MRPHLNO-090616-23
Name
MO1-fut8a
Previous Names
  • MO1-fut8
Target
Sequence
5' - CGCCTACTGCTGCCCTCCCCTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fut8a
No data available
Phenotype
Phenotype resulting from MO1-fut8a
Phenotype Fish Figures
alpha-(1->6)-fucosyltransferase activity disrupted, abnormal AB + MO1-fut8a Fig. 6 with image from Seth et al., 2010
cell population proliferation increased occurrence, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
cranial nerve X position, abnormal rw0Tg + MO1-fut8a Fig. 8 with image from Ohata et al., 2009
eye decreased distance eye, abnormal AB + MO1-fut8a Fig. 2 with image from Seth et al., 2010
eye decreased size, abnormal AB + MO1-fut8a Fig. 2 with imageFig. 3 with imageFig. 4 with image from Seth et al., 2010
eye physical object quality, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
forebrain decreased size, abnormal AB + MO1-fut8a Fig. 2 with image from Seth et al., 2010
fourth ventricle swollen, abnormal AB + MO1-fut8a Fig. 2 with image from Seth et al., 2010
hindbrain commissure decreased amount, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
motor neuron disorganized, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
motor neuron position, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
muscle cell H zone absent, abnormal WT + MO1-fut8a Figure 5 with image from Hayashiji et al., 2022
muscle cell Z disc disassembled, abnormal WT + MO1-fut8a Figure 5 with image from Hayashiji et al., 2022
myoseptum broken, abnormal WT + MO1-fut8a Figure 4 with image from Hayashiji et al., 2022
myoseptum detached from muscle cell, abnormal WT + MO1-fut8a Figure 4 with image from Hayashiji et al., 2022
myoseptum morphology, abnormal WT + MO1-fut8a Figure 3 with image from Hayashiji et al., 2022
neural crest cell position, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
neural crest cell migration delayed, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
optic stalk decreased length, abnormal AB + MO1-fut8a Fig. 4 with image from Seth et al., 2010
optic stalk increased thickness, abnormal AB + MO1-fut8a Fig. 4 with image from Seth et al., 2010
photoreceptor cell decreased amount, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
retina decreased size, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
retina lacks parts or has fewer parts of type Muller cell, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
retina lacks parts or has fewer parts of type retinal ganglion cell, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
retina structure, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
retina development in camera-type eye disrupted, abnormal AB + MO1-fut8a Fig. 4 with image from Seth et al., 2010
retinal ganglion cell decreased amount, abnormal AB + MO1-fut8a Fig. 4 with image from Seth et al., 2010
skeletal muscle morphology, abnormal WT + MO1-fut8a Figure 2 with image from Hayashiji et al., 2022
skeletal muscle refractivity, abnormal WT + MO1-fut8a Figure 1 with image from Hayashiji et al., 2022
skeletal muscle sarcomere morphology, abnormal WT + MO1-fut8a Figure 5 with image from Hayashiji et al., 2022
somite has fewer parts of type slow muscle cell, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
somite U-shaped, abnormal AB + MO1-fut8a Fig. 2 with imageFig. 5 with image from Seth et al., 2010
somite muscle cell decreased length, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
spinal cord curvature, abnormal WT + MO1-fut8a Figure 1 with image from Hayashiji et al., 2022
spinal cord lacks all parts of type motor neuron neuron projection, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
splanchnocranium lacks all parts of type mandibular arch skeleton, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
whole organism decreased life span, abnormal WT + MO1-fut8a Figure 1 with image from Hayashiji et al., 2022
whole organism decreased size, abnormal WT + MO1-fut8a Figure 1 with image from Hayashiji et al., 2022
whole organism increased curvature, abnormal AB + MO1-fut8a Fig. 2 with image from Seth et al., 2010
whole organism lacks all parts of type dorsal root ganglion neuron projection, abnormal AB + MO1-fut8a Fig. 5 with image from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal AB + MO1-fut8a Fig. 3 with image from Seth et al., 2010
whole organism protein O-linked glycosylation via fucose decreased occurrence, abnormal WT + MO1-fut8a Figure 1 with image from Hayashiji et al., 2022
Phenotype of all Fish created by or utilizing MO1-fut8a
Phenotype Fish Conditions Figures
spinal cord lacks all parts of type motor neuron neuron projection, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
splanchnocranium lacks all parts of type mandibular arch skeleton, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
optic stalk decreased length, abnormal AB + MO1-fut8a standard conditions Fig. 4 with image from Seth et al., 2010
photoreceptor cell decreased amount, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
whole organism lacks all parts of type dorsal root ganglion neuron projection, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
eye decreased distance eye, abnormal AB + MO1-fut8a standard conditions Fig. 2 with image from Seth et al., 2010
hindbrain commissure decreased amount, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
somite U-shaped, abnormal AB + MO1-fut8a standard conditions Fig. 2 with imageFig. 5 with image from Seth et al., 2010
retina development in camera-type eye disrupted, abnormal AB + MO1-fut8a standard conditions Fig. 4 with image from Seth et al., 2010
motor neuron disorganized, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
somite muscle cell decreased length, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
eye decreased size, abnormal AB + MO1-fut8a standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Seth et al., 2010
forebrain decreased size, abnormal AB + MO1-fut8a standard conditions Fig. 2 with image from Seth et al., 2010
alpha-(1->6)-fucosyltransferase activity disrupted, abnormal AB + MO1-fut8a standard conditions Fig. 6 with image from Seth et al., 2010
retina lacks parts or has fewer parts of type Muller cell, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
somite has fewer parts of type slow muscle cell, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
motor neuron position, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
retina decreased size, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
eye physical object quality, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
retina structure, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
neural crest cell migration delayed, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
whole organism increased curvature, abnormal AB + MO1-fut8a standard conditions Fig. 2 with image from Seth et al., 2010
cell population proliferation increased occurrence, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
neural crest cell position, abnormal AB + MO1-fut8a standard conditions Fig. 5 with image from Seth et al., 2010
optic stalk increased thickness, abnormal AB + MO1-fut8a standard conditions Fig. 4 with image from Seth et al., 2010
retina lacks parts or has fewer parts of type retinal ganglion cell, abnormal AB + MO1-fut8a standard conditions Fig. 3 with image from Seth et al., 2010
fourth ventricle swollen, abnormal AB + MO1-fut8a standard conditions Fig. 2 with image from Seth et al., 2010
retinal ganglion cell decreased amount, abnormal AB + MO1-fut8a standard conditions Fig. 4 with image from Seth et al., 2010
whole organism protein O-linked glycosylation via fucose decreased occurrence, abnormal WT + MO1-fut8a standard conditions Figure 1 with image from Hayashiji et al., 2022
myoseptum detached from muscle cell, abnormal WT + MO1-fut8a standard conditions Figure 4 with image from Hayashiji et al., 2022
whole organism decreased size, abnormal WT + MO1-fut8a standard conditions Figure 1 with image from Hayashiji et al., 2022
muscle cell Z disc disassembled, abnormal WT + MO1-fut8a standard conditions Figure 5 with image from Hayashiji et al., 2022
muscle cell H zone absent, abnormal WT + MO1-fut8a standard conditions Figure 5 with image from Hayashiji et al., 2022
spinal cord curvature, abnormal WT + MO1-fut8a standard conditions Figure 1 with image from Hayashiji et al., 2022
skeletal muscle sarcomere morphology, abnormal WT + MO1-fut8a standard conditions Figure 5 with image from Hayashiji et al., 2022
whole organism decreased life span, abnormal WT + MO1-fut8a standard conditions Figure 1 with image from Hayashiji et al., 2022
myoseptum morphology, abnormal WT + MO1-fut8a standard conditions Figure 3 with image from Hayashiji et al., 2022
myoseptum broken, abnormal WT + MO1-fut8a standard conditions Figure 4 with image from Hayashiji et al., 2022
skeletal muscle morphology, abnormal WT + MO1-fut8a standard conditions Figure 2 with image from Hayashiji et al., 2022
skeletal muscle refractivity, abnormal WT + MO1-fut8a standard conditions Figure 1 with image from Hayashiji et al., 2022
cranial nerve X position, abnormal rw0Tg + MO1-fut8a standard conditions Fig. 8 with image from Ohata et al., 2009
Citations