Morpholino

MO1-ccbe1

ID
ZDB-MRPHLNO-090507-1
Name
MO1-ccbe1
Previous Names
  • ccbe1 ATG MO (1)
Target
Sequence
5' - CGGGTAGATCATTTCAGACACTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccbe1
No data available
Phenotype
Phenotype resulting from MO1-ccbe1
Phenotype Fish Figures
dorsal longitudinal lymphatic vessel aplastic, abnormal y1Tg + MO1-ccbe1 Fig. 1 from Hogan et al., 2009
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
intersegmental lymph vessel aplastic, abnormal y1Tg + MO1-ccbe1 Fig. 1 from Hogan et al., 2009
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO1-ccbe1 Fig. S5 with image from Astin et al., 2014
lymphangioblast cord absent, abnormal y1Tg + MO1-ccbe1 Fig. 6 with image from Le Guen et al., 2014
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 Fig. 3 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 Fig. 1,  Fig. 2 from Hogan et al., 2009
MAPK cascade disrupted, abnormal y1Tg + MO1-ccbe1 Fig. 4 with image from Le Guen et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO1-ccbe1 Fig. S7 from Bower et al., 2017
posterior cardinal vein ab9-mapk labeling decreased distribution, abnormal y1Tg + MO1-ccbe1 Fig. 4 with image from Kärpanen et al., 2017
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO1-ccbe1 Fig. S2 with image from Astin et al., 2014
thoracic duct aplastic, abnormal y1Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
Fig. 2 from Alders et al., 2009
Fig. 1 from Hogan et al., 2009
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 Fig. 3 with image from Weijts et al., 2013
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-ccbe1 Fig. 2 from Hogan et al., 2009
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO1-ccbe1 Fig. 6 with image from Le Guen et al., 2014
Phenotype of all Fish created by or utilizing MO1-ccbe1
Phenotype Fish Conditions Figures
thoracic duct aplastic, abnormal WT + MO1-ccbe1 standard conditions Fig. 2 from Alders et al., 2009
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4453Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. S2 with image from Astin et al., 2014
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
thoracic duct aplastic, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
thoracic duct aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
dorsal longitudinal lymphatic vessel aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
MAPK cascade disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 4 with image from Le Guen et al., 2014
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 6 with image from Le Guen et al., 2014
posterior cardinal vein ab9-mapk labeling decreased distribution, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 4 with image from Kärpanen et al., 2017
intersegmental lymph vessel aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
lymphangioblast cord absent, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 6 with image from Le Guen et al., 2014
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 3 with image from Weijts et al., 2013
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO1-ccbe1 standard conditions Fig. S5 with image from Astin et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO1-ccbe1 standard conditions Fig. S7 from Bower et al., 2017
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
angiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal s916Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 2 from Crawford et al., 2016
lymph vessel EGFP expression absent, abnormal s916Tg; y1Tg + MO1-ccbe1 control Fig. 2 from Crawford et al., 2016
thoracic duct absent, abnormal s916Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 2 from Crawford et al., 2016
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel separated from dorsal longitudinal anastomotic vessel, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.