Morpholino

MO1-mir126

ID
ZDB-MRPHLNO-090112-4
Name
MO1-mir126
Previous Names
  • dre-miR-126 MO-1 (1)
  • MOMB (1)
Targets
Sequence
5' - TGCATTATTACTCACGGTACGAGTTTGAGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir126
Phenotype
Phenotype resulting from MO1-mir126
No data available
Phenotype of all Fish created by or utilizing MO1-mir126
Phenotype Fish Conditions Figures
nucleate erythrocyte increased amount, abnormal AB + MO1-mir126 standard conditions Fig. 4 from Grabher et al., 2011
thrombocyte decreased amount, abnormal AB + MO1-mir126 standard conditions Fig. 4 from Grabher et al., 2011
brain hemorrhagic, abnormal WT + MO1-mir126 standard conditions Fig. S7 with image from Kontarakis et al., 2018
thoracic duct absent, abnormal ci1Tg + MO1-mir126 standard conditions Fig. S6 with image from Kontarakis et al., 2018
thoracic duct hypoplastic, abnormal ci1Tg + MO1-mir126 standard conditions Fig. S6 with image from Kontarakis et al., 2018
aortic arch 5 absent, abnormal la116Tg + MO1-mir126 standard conditions Fig. 3 from Nicoli et al., 2010
thoracic duct hypoplastic, abnormal nz101Tg + MO1-mir126 standard conditions Fig. S5 with image from Kontarakis et al., 2018
thoracic duct absent, abnormal nz101Tg + MO1-mir126 standard conditions Fig. S5 with image from Kontarakis et al., 2018
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a + MO1-mir126 standard conditions Fig. 3 from Nicoli et al., 2010
blood vessel morphogenesis disrupted, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
dorsal aorta unlumenized, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
blood decreased fluid flow, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
nucleate erythrocyte mislocalised, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
blood vasculature broken, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
posterior cardinal vein decreased width, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
cranial vasculature broken, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
pharyngeal vasculature decreased width, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
dorsal aorta decreased width, abnormal s843Tg; sd2Tg + MO1-mir126 + MO2-mir126a standard conditions Fig. 3 with image from Fish et al., 2008
lymph vessel development disrupted, abnormal flt4hu4602/+; nz101Tg + MO1-mir126 standard conditions Fig. 3 with image from Kontarakis et al., 2018
medial facial lymph vessel decreased length, abnormal flt4hu4602/+; nz101Tg + MO1-mir126 standard conditions Fig. 3 with image from Kontarakis et al., 2018
lateral facial lymph vessel decreased length, abnormal flt4hu4602/+; nz101Tg + MO1-mir126 standard conditions Fig. 3 with image from Kontarakis et al., 2018
thoracic duct absent, abnormal flt4hu4602/+; y1Tg + MO1-mir126 standard conditions Fig. 3 with image from Kontarakis et al., 2018
Citations