header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MIRNAG-090112-2
miRNA Gene Name: microRNA 126a
miRNA Gene Symbol: mir126a
Sequence Ontology ID : SO:0001265

{{control.fieldName}} Edit

ID: {{control.nomenID}}
{{control.fieldName}}:
Reason:
Comments:

Attributions

{{pub.zdbID}}
Previous Names: miR-126 (1), miR126 (1), mir126

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Location: Chr: 8 Mapping Details/Browsers
Nomenclature History
Note: full hairpin sequence from miRBase >dre-mir-126 MI0001979 GAGCCAUUUUAACUGCUUCACAGUCCAUUAUUACUUUUGGUACGCGCUAGGCCAGACUCAAACUCGUACCGUGAGUAAUAAUGCACUGUGGCAGUGGGUUU
AUTOMATED DESCRIPTION
Involved in several processes, including circulatory system development; gene silencing by miRNA; and regulation of signal transduction. Orthologous to human MIR126 (microRNA 126).
MUTATIONS AND SEQUENCE TARGETING REAGENTS
Allele Type Localization Consequence Mutagen Suppliers
bns2 Small Deletion Unknown Unknown TALEN
sih1 Small Deletion Unknown Unknown CRISPR
sih2 Small Deletion Unknown Unknown CRISPR
Targeting reagents:
DISEASE ASSOCIATED WITH mir126a HUMAN ORTHOLOG No data available
DISEASE ASSOCIATED WITH mir126a VIA EXPERIMENTAL MODELS No data available
GENE ONTOLOGY
Ontology GO Term
Biological Process gene silencing by miRNA (more)
GO Terms (all 10)
TRANSCRIPTS
Type Name Length (bp) Analysis
miRNA mir126-001 (1) 21
mir126*-002 (1) 21
GENE PRODUCT DESCRIPTION No description available
INTERACTIONS AND PATHWAYS
PLASMIDSNo data available
CONSTRUCTS WITH SEQUENCES FROM mir126a No data available
MARKER RELATIONSHIPS
mir126aContained in: [BAC] CH211-248E11 (1) (order this)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA miRBASE Stem Loop:MI0001979 (1) 101bp
Genomic GenBank:CR361566 (1) 182625bp
Select Tool
OTHER mir126a MIRNA GENE PAGES
  • Alliance (1)
  • ORTHOLOGY for mir126a (Chr: 8)
    CITATIONS (31)