miRNA Gene

mir126a

ID
ZDB-MIRNAG-090112-2
Name
microRNA 126a
Symbol
mir126a Nomenclature History
Previous Names
  • miR-126 (1)
  • miR126 (1)
  • mir126
Type
miRNA_gene
Location
Chr: 8 Mapping Details/Browsers
Description
Acts upstream of or within several processes, including circulatory system development; gene silencing by miRNA; and regulation of signal transduction. Is expressed in cardiovascular system. Orthologous to human MIR126 (microRNA 126).
Genome Resources
Note
full hairpin sequence from miRBase >dre-mir-126 MI0001979 GAGCCAUUUUAACUGCUUCACAGUCCAUUAUUACUUUUGGUACGCGCUAGGCCAGACUCAAACUCGUACCGUGAGUAAUAAUGCACUGUGGCAGUGGGUUU
Comparative Information
Expression
All Expression Data
10 figures from 10 publications
Cross-Species Comparison
High Throughput Data
Thisse Expression Data
No data available
Wild Type Expression Summary
Phenotype
All Phenotype Data
8 figures from 3 publications
Cross-Species Comparison
Alliance
Phenotype Summary
Mutations
Mutants
Sequence Targeting Reagents
Human Disease
Associated With mir126a Human Ortholog
No data available
Associated With mir126a Via Experimental Models
No data available
Gene Ontology
Protein Domains
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
Transcripts
Genome Browsers
No data available
Interactions and Pathways
No data available
Antibodies
No data available
Plasmids
No data available
Constructs
Marker Relationships
Sequences
Orthology
Comparative Orthology
Alliance
Gene Tree
Ensembl
Citations