miRNA Gene
mir126a
- ID
- ZDB-MIRNAG-090112-2
- Name
- microRNA 126a
- Symbol
- mir126a Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 8 Mapping Details/Browsers
- Description
- Acts upstream of or within several processes, including circulatory system development; miRNA-mediated post-transcriptional gene silencing; and regulation of signal transduction. Is expressed in cardiovascular system. Orthologous to human MIR126 (microRNA 126).
- Genome Resources
- Note
-
full hairpin sequence from miRBase >dre-mir-126 MI0001979 GAGCCAUUUUAACUGCUUCACAGUCCAUUAUUACUUUUGGUACGCGCUAGGCCAGACUCAAACUCGUACCGUGAGUAAUAAUGCACUGUGGCAGUGGGUUU
- Comparative Information
-
- All Expression Data
- 10 figures from 10 publications
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA |
mir126a-201
(1)
|
Ensembl | 101 nt | ||
| miRNA | mir126-001 (1) | 21 nt | |||
| miRNA | mir126*-002 (1) | 21 nt |
1 - 3 of 3
Interactions and Pathways
No data available
Plasmids
| Relationship | Marker Type | Marker | Citations |
|---|---|---|---|
| Contained in | BAC | CH211-248E11 | ZFIN Curated Data |
1 - 1 of 1
Show
| Type | Accession # | Sequence | Length (nt/aa) | Analysis |
|---|---|---|---|---|
| RNA | RefSeq:NR_030071 (1) | |||
| Genomic | GenBank:CR361566 (1) | 182625 nt |
- Wright, K., Han, D.J., Song, R., de Silva, K., Plain, K.M., Purdie, A.C., Shepherd, A., Chin, M., Hortle, E., Wong, J.J., Britton, W.J., Oehlers, S.H. (2024) Zebrafish tsc1 and cxcl12a increase susceptibility to mycobacterial infection. Life science alliance. 7(4):
- Zhang, X., Yang, F., Liu, F., Tian, Q., Hu, M., Li, P., Zeng, Y. (2022) Conservation of Differential Animal MicroRNA Processing by Drosha and Dicer. Frontiers in molecular biosciences. 8:730006
- Domingues, W.B., Silveira, T.L.R., Nunes, L.S., Blodorn, E.B., Schneider, A., Corcine, C.D., Varela Junior, A.S., Acosta, I.B., Kütter, M.T., Greif, G., Robello, C., Pinhal, D., Marins, L.F., Campos, V.F. (2021) GH Overexpression Alters Spermatic Cells MicroRNAome Profile in Transgenic Zebrafish. Frontiers in genetics. 12:704778
- Siegerist, F., Lange, T., Iervolino, A., Koppe, T.M., Zhou, W., Capasso, G., Endlich, K., Endlich, N. (2021) Evaluation of endogenous miRNA reference genes across different zebrafish strains, developmental stages and kidney disease models. Scientific Reports. 11:22894
- Zhang, X., Li, Y., Zhang, Y., Li, S. (2021) Characterization of small RNAs in early zebrafish PGCs. Acta biochimica et biophysica Sinica. 53(4):514-516
- Lv, H., Liu, B., Qin, Y. (2020) Isosorbide mononitrate promotes angiogenesis in embryonic development of zebrafish. Genetics and Molecular Biology. 43:20190233
- Zapilko, V., Fish, R.J., Garcia, A., Reny, J.L., Dunoyer-Geindre, S., Lecompte, T., Neerman-Arbez, M., Fontana, P. (2020) MicroRNA-126 is a regulator of platelet-supported thrombin generation. Platelets. 31(6):746-755
- Moro, A., Driscoll, T.P., Boraas, L.C., Armero, W., Kasper, D.M., Baeyens, N., Jouy, C., Mallikarjun, V., Swift, J., Ahn, S.J., Lee, D., Zhang, J., Gu, M., Gerstein, M., Schwartz, M., Nicoli, S. (2019) MicroRNA-dependent regulation of biomechanical genes establishes tissue stiffness homeostasis. Nature cell biology. 21(3):348-358
- Kontarakis, Z., Rossi, A., Ramas, S., Dellinger, M.T., Stainier, D.Y.R. (2018) Mir-126 is a conserved modulator of lymphatic development. Developmental Biology. 437(2):120-130
- Kasper, D.M., Moro, A., Ristori, E., Narayanan, A., Hill-Teran, G., Fleming, E., Moreno-Mateos, M., Vejnar, C.E., Zhang, J., Lee, D., Gu, M., Gerstein, M., Giraldez, A., Nicoli, S. (2017) MicroRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos. Developmental Cell. 40:552-565.e5
1 - 10 of 32
Show