Morpholino

MO1-gfi1aa

ID
ZDB-MRPHLNO-090106-5
Name
MO1-gfi1aa
Previous Names
  • MO1-gfi1.1
  • MO1-gfi1a
Target
Sequence
5' - GTAAACATGCCGAGGTCATTTTTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gfi1aa
Phenotype
Phenotype resulting from MO1-gfi1aa
Phenotype of all Fish created by or utilizing MO1-gfi1aa
Citations