Morpholino

MO3-mapk3

ID
ZDB-MRPHLNO-081020-5
Name
MO3-mapk3
Previous Names
  • ERK1-MO (1)
Target
Sequence
5' - TCTGTCCGCAAATCGTCGCCTTCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mapk3
Expressed Gene Anatomy Figures
cdh2 Fig. 4 with image from Krens et al., 2008
chrd Fig. S3 with image from Krens et al., 2008
ctslb Fig. 2 with image from Krens et al., 2008
dlx3b Fig. 2 with image from Krens et al., 2008
etv5b Fig. 4 with image from Krens et al., 2008
fosab Fig. 4 with image from Krens et al., 2008
gata2a Fig. S3 with image from Krens et al., 2008
gsc Fig. 10 with image from Krens et al., 2008
Fig. S3 with image from Krens et al., 2008
lft1 Fig. 10 with image from Krens et al., 2008
mos Fig. 4 with image from Krens et al., 2008
mycn Fig. 4 with image from Krens et al., 2008
ndr2 Fig. S3 with image from Krens et al., 2008
otx2b Fig. S3 with image from Krens et al., 2008
shha Fig. 2 with image from Krens et al., 2008
snai1a Fig. 4 with image from Krens et al., 2008
Fig. S3 with image from Krens et al., 2008
sox17 Fig. S3 with image from Krens et al., 2008
tbx16l Fig. 10 with image from Krens et al., 2008
Fig. 6 with image from Krens et al., 2008
tbxta Fig. 10 with image from Krens et al., 2008
Fig. 6 with image,  Fig. S3 with image from Krens et al., 2008
vegfaa Fig. 4 with image from Krens et al., 2008
vent Fig. 10 with image from Krens et al., 2008
vox Fig. 10 with image from Krens et al., 2008
Phenotype
Phenotype resulting from MO3-mapk3
Phenotype Fish Figures
convergent extension involved in gastrulation disrupted, abnormal WT + MO3-mapk3 Fig. 3 with image from Krens et al., 2008
head deformed, abnormal WT + MO3-mapk3 Fig. S2 with image from Krens et al., 2008
margin disorganized, abnormal WT + MO3-mapk3 Fig. 1 with image from Krens et al., 2008
notochord increased width, abnormal WT + MO3-mapk3 Fig. 2 with image from Krens et al., 2008
pericardial cavity edematous, abnormal WT + MO3-mapk3 Fig. 1 with image from Krens et al., 2008
post-vent region decreased length, abnormal WT + MO3-mapk3 Fig. S2 with image from Krens et al., 2008
post-vent region deformed, abnormal WT + MO3-mapk3 Fig. S2 with image from Krens et al., 2008
somite deformed, abnormal WT + MO3-mapk3 Fig. 1 with image from Krens et al., 2008
trunk decreased length, abnormal WT + MO3-mapk3 Fig. S2 with image from Krens et al., 2008
whole organism decreased length, abnormal WT + MO3-mapk3 Fig. 1 with image from Krens et al., 2008
Phenotype of all Fish created by or utilizing MO3-mapk3
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal WT + MO3-mapk3 standard conditions Fig. 1 with image from Krens et al., 2008
post-vent region decreased length, abnormal WT + MO3-mapk3 standard conditions Fig. S2 with image from Krens et al., 2008
head deformed, abnormal WT + MO3-mapk3 standard conditions Fig. S2 with image from Krens et al., 2008
notochord increased width, abnormal WT + MO3-mapk3 standard conditions Fig. 2 with image from Krens et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO3-mapk3 standard conditions Fig. 3 with image from Krens et al., 2008
somite deformed, abnormal WT + MO3-mapk3 standard conditions Fig. 1 with image from Krens et al., 2008
post-vent region deformed, abnormal WT + MO3-mapk3 standard conditions Fig. S2 with image from Krens et al., 2008
pericardial cavity edematous, abnormal WT + MO3-mapk3 standard conditions Fig. 1 with image from Krens et al., 2008
trunk decreased length, abnormal WT + MO3-mapk3 standard conditions Fig. S2 with image from Krens et al., 2008
margin disorganized, abnormal WT + MO3-mapk3 standard conditions Fig. 1 with image from Krens et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.