header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081020-5
Morpholino Name: MO3-mapk3
Target: mapk3 (1)
Previous Name: ERK1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTGTCCGCAAATCGTCGCCTTCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-mapk3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-mapk3
Expressed Gene Anatomy Figures
cdh2 Fig. 4 with image from Krens et al., 2008
chrd Fig. S3 with image from Krens et al., 2008
ctslb Fig. 2 with image from Krens et al., 2008
dlx3b Fig. 2 with image from Krens et al., 2008
etv5b Fig. 4 with image from Krens et al., 2008
fosab Fig. 4 with image from Krens et al., 2008
gata2a Fig. S3 with image from Krens et al., 2008
gsc Fig. 10 with image from Krens et al., 2008
Fig. S3 with image from Krens et al., 2008
lft1 Fig. 10 with image from Krens et al., 2008
mos Fig. 4 with image from Krens et al., 2008
mycn Fig. 4 with image from Krens et al., 2008
ndr2 Fig. S3 with image from Krens et al., 2008
otx2b Fig. S3 with image from Krens et al., 2008
shha Fig. 2 with image from Krens et al., 2008
snai1a Fig. 4 with image from Krens et al., 2008
Fig. S3 with image from Krens et al., 2008
sox17 Fig. S3 with image from Krens et al., 2008
tbx16l Fig. 10 with image from Krens et al., 2008
Fig. 6 with image from Krens et al., 2008
tbxta Fig. 10 with image from Krens et al., 2008
Fig. 6 with imageFig. S3 with image from Krens et al., 2008
vegfaa Fig. 4 with image from Krens et al., 2008
vent Fig. 10 with image from Krens et al., 2008
vox Fig. 10 with image from Krens et al., 2008
PHENOTYPE
Phenotype resulting from MO3-mapk3
Phenotype of all Fish created by or utilizing MO3-mapk3
OTHER MO3-mapk3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)