Morpholino
MO2-ptpn11a
- ID
- ZDB-MRPHLNO-080801-1
- Name
- MO2-ptpn11a
- Previous Names
-
- MO2-ptpn11
- Shp2-MO (1)
- Target
- Sequence
-
5' - GGTGGAACCACCTTCGGGATGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptpn11a
Expressed Gene | Anatomy | Figures |
---|---|---|
bmp2b |
Fig. 3
from Jopling et al., 2007 |
|
chrd |
Fig. 3
from Jopling et al., 2007 |
|
egr2b |
Fig. 3
from Jopling et al., 2007 |
|
fyna |
Fig. 3
from Jopling et al., 2007 |
|
gsc |
Fig. 3
from Jopling et al., 2007 |
|
ndr2 |
Fig. 3
from Jopling et al., 2007 |
|
pax2a |
Fig. 3
from Jopling et al., 2007 |
|
six3b |
Fig. 3
from Jopling et al., 2007 |
|
tbxta |
Fig. 3
from Jopling et al., 2007 |
|
wnt5b |
Fig. 3
from Jopling et al., 2007 |
|
wnt11f2 |
Fig. 3
from Jopling et al., 2007 |
|
yes1 |
Fig. 3
from Jopling et al., 2007 |
Phenotype
Phenotype resulting from MO2-ptpn11a
Phenotype of all Fish created by or utilizing MO2-ptpn11a
Citations