header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080715-1
Morpholino Name: MO4-wt1a
Target: wt1a (1)
Sequence:
5' - GAGCAAGAGATACTGACCTGAAGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-wt1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-wt1a
Expressed Gene Anatomy Figures
tbx18 Fig. 4 with image from Powell et al., 2016
tcf21 Fig. 4 with image from Powell et al., 2016
Fig. 4 with image from Serluca, 2008
PHENOTYPE
Phenotype resulting from MO4-wt1a
Phenotype of all Fish created by or utilizing MO4-wt1a
Genome Resources:
CITATIONS (2)