Morpholino

MO1-spint1a

ID
ZDB-MRPHLNO-071218-5
Name
MO1-spint1a
Previous Names
None
Target
Sequence
5' - ACCCTGAGTAGAGCCAGAGTCATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 17
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spint1a
Expressed Gene Anatomy Figures
il1b Fig. 7 from Schepis et al., 2018
mmp9 Fig. 7 from Schepis et al., 2018
mmp13a.1 Fig. 7 from Schepis et al., 2018
Phenotype
Phenotype resulting from MO1-spint1a
Phenotype Fish Figures
chorion accumulation keratinocyte, abnormal WT + MO1-spint1a Fig. 3 with image from Carney et al., 2007
epidermal basal stratum cell protruding out of epidermis, abnormal WT + MO1-spint1a Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell motility increased occurrence, abnormal cy34Tg + MO1-spint1a Fig. 4 with image,  Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell population proliferation increased occurrence, abnormal cy34Tg + MO1-spint1a Fig. 7,  Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion decreased process quality, abnormal la213Tg; mu271Tg + MO1-spint1a Fig. 4 with image,  Fig. 7,  Fig. 8 from Schepis et al., 2018
epidermal basal stratum cytoplasm ab2-cdh1 labeling mislocalised, abnormal cy34Tg + MO1-spint1a Fig. 5 with image from Schepis et al., 2018
epidermal basal stratum keratinocyte aggregated, abnormal WT + MO1-spint1a Fig. 3 with image from Carney et al., 2007
epidermal superficial stratum cell population proliferation increased occurrence, abnormal cy34Tg + MO1-spint1a Fig. 6 with image,  Fig. 7,  Fig. 8 from Schepis et al., 2018
epidermis development disrupted, abnormal WT + MO1-spint1a Fig. 3 with image from Carney et al., 2007
epithelial cell protruding out of epidermal superficial stratum, abnormal cy34Tg + MO1-spint1a Fig. 3 with image,  Fig. 7,  Fig. 8 from Schepis et al., 2018
integument cell aggregated, abnormal WT + MO1-spint1a Fig. 2 with image from Schepis et al., 2018
keratinocyte disorganized, abnormal WT + MO1-spint1a Fig. 5 with image from Carney et al., 2007
keratinocyte mislocalised, abnormal WT + MO1-spint1a Fig. 3 with image from Carney et al., 2007
peridermal cell protruding out of epidermis, abnormal WT + MO1-spint1a Fig. 5 from Armistead et al., 2020
whole organism mmp13a.1 expression increased amount, abnormal WT + MO1-spint1a Fig. 7 from Schepis et al., 2018
whole organism il1b expression increased amount, abnormal WT + MO1-spint1a Fig. 7 from Schepis et al., 2018
whole organism mmp9 expression increased amount, abnormal WT + MO1-spint1a Fig. 7 from Schepis et al., 2018
Phenotype of all Fish created by or utilizing MO1-spint1a
Phenotype Fish Conditions Figures
whole organism mmp9 expression amount, ameliorated AB + MO1-spint1a hypotonic, chemical treatment by environment: mannitol Fig 1 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated AB + MO1-spint1a hypotonic, chemical treatment by environment: mannitol Fig 1 with image from Hatzold et al., 2023
whole organism mmp9 expression increased amount, abnormal AB + MO1-spint1a hypotonic Fig 1 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions increased amount, abnormal AB + MO1-spint1a hypotonic Fig 1 with image from Hatzold et al., 2023
epidermal basal stratum cell protruding out of epidermis, abnormal WT + MO1-spint1a control Fig. 5 from Armistead et al., 2020
epidermis development disrupted, abnormal WT + MO1-spint1a standard conditions Fig. 3 with image from Carney et al., 2007
keratinocyte mislocalised, abnormal WT + MO1-spint1a standard conditions Fig. 3 with image from Carney et al., 2007
whole organism mmp13a.1 expression increased amount, abnormal WT + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
peridermal cell protruding out of epidermis, abnormal WT + MO1-spint1a control Fig. 5 from Armistead et al., 2020
whole organism mmp9 expression increased amount, abnormal WT + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
integument cell aggregated, abnormal WT + MO1-spint1a standard conditions Fig. 2 with image from Schepis et al., 2018
epidermal basal stratum keratinocyte aggregated, abnormal WT + MO1-spint1a standard conditions Fig. 3 with image from Carney et al., 2007
chorion accumulation keratinocyte, abnormal WT + MO1-spint1a standard conditions Fig. 3 with image from Carney et al., 2007
keratinocyte disorganized, abnormal WT + MO1-spint1a standard conditions Fig. 5 with image from Carney et al., 2007
whole organism il1b expression increased amount, abnormal WT + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, abnormal cy22Tg + MO1-spint1a standard conditions Fig. 3 with image from Schepis et al., 2018
epidermal basal stratum cell population proliferation increased occurrence, abnormal cy34Tg + MO1-spint1a standard conditions Fig. 7,  Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated cy34Tg + MO1-spint1a chemical treatment: matrix metalloproteinase inhibitor Fig. 7 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, abnormal cy34Tg + MO1-spint1a standard conditions Fig. 7,  Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, abnormal cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, exacerbated cy34Tg + MO1-spint1a chemical treatment: matrix metalloproteinase inhibitor Fig. 7 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, abnormal cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, abnormal cy34Tg + MO1-spint1a standard conditions Fig. 6 with image,  Fig. 7,  Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell motility increased occurrence, abnormal cy34Tg + MO1-spint1a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cytoplasm ab2-cdh1 labeling mislocalised, abnormal cy34Tg + MO1-spint1a standard conditions Fig. 5 with image from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated la213Tg; mu271Tg + MO1-spint1a chemical treatment: matrix metalloproteinase inhibitor Fig. 7 from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated la213Tg; mu271Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell motility increased occurrence, abnormal la213Tg; mu271Tg + MO1-spint1a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion decreased process quality, abnormal la213Tg; mu271Tg + MO1-spint1a standard conditions Fig. 4 with image,  Fig. 7,  Fig. 8 from Schepis et al., 2018
whole organism mmp13a.1 expression amount, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
integument cell aggregated, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 2 with image from Schepis et al., 2018
whole organism il1b expression amount, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp9 expression amount, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
keratinocyte proliferation increased occurrence, abnormal spint1ahi2217Tg/hi2217Tg + MO1-spint1a + MO1-spint1b standard conditions Fig. 4 with image from Carney et al., 2007
integument cell aggregated, ameliorated WT + MO1-f2rl1.2 + MO1-spint1a standard conditions Fig. 2 with image from Schepis et al., 2018
chorion accumulation keratinocyte, abnormal WT + MO1-spint1a + MO1-spint1b standard conditions Fig. 3 with image from Carney et al., 2007
epidermal basal stratum keratinocyte aggregated, abnormal WT + MO1-spint1a + MO1-spint1b standard conditions Fig. 3 with image from Carney et al., 2007
keratinocyte mislocalised, abnormal WT + MO1-spint1a + MO1-spint1b standard conditions Fig. 3 with image from Carney et al., 2007
keratinocyte disorganized, abnormal WT + MO1-spint1a + MO1-spint1b standard conditions Fig. 5 with image from Carney et al., 2007
epidermis development disrupted, abnormal WT + MO1-spint1a + MO1-spint1b standard conditions Fig. 3 with image from Carney et al., 2007
integument cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 2 with image from Schepis et al., 2018
whole organism mmp13a.1 expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a control Fig. 5 from Armistead et al., 2020
whole organism il1b expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp9 expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, exacerbated WT + MO1-spint1a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, exacerbated WT + MO1-spint1a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, exacerbated WT + MO1-spint1a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, exacerbated WT + MO1-spint1a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, exacerbated WT + MO1-spint1a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, exacerbated WT + MO1-spint1a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epithelial cell protruding out of epidermal superficial stratum, ameliorated cy22Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 3 with image from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, abnormal cy34Tg + MO1-erbb2 + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated cy34Tg + MO1-erbb2 + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, abnormal cy34Tg + MO1-erbb2 + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, abnormal cy34Tg + MO1-spint1a + MO2-mmp9 + MO3-mmp9 standard conditions Fig. 7 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, abnormal cy34Tg + MO1-spint1a + MO2-mmp9 + MO3-mmp9 chemical treatment: matrix metalloproteinase inhibitor Fig. 7 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy22Tg + MO1-spint1a standard conditions Fig. 3 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 6 with image from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell-cell junction ab2-cdh1 labeling position, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 5 with image from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, exacerbated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 6 with image,  Fig. 8 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated f2rl1.2sfc18b/sfc18b; la213Tg; mu271Tg + MO1-spint1a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; la213Tg; mu271Tg + MO1-spint1a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated la213Tg; mu271Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated la213Tg; mu271Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 4 with image from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-erbb2 + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-erbb2 + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-erbb2 + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
Citations
TSV
1 - 7 of 7
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.