Morpholino

MO3-ctnnb2

ID

ZDB-MRPHLNO-071126-1

Name

MO3-ctnnb2

Previous Names

Target

Sequence

5' - AGCCATCGTTGCGTCAATCCTTTAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ctnnb2

Expressed Gene	Anatomy	Figures
bmp2b	unspecified	Fig. 8 from Rui et al., 2007
chrd	(not) organizer inducing center unspecified whole organism dorsal region	Fig. 7 from Lu et al., 2017 Fig. 8 from Rui et al., 2007 Fig. 5 from Xiong et al., 2006
dharma	anatomical structure (not) organizer inducing center	Fig. 7 from Lu et al., 2017 Fig. 5 from Xiong et al., 2006
eve1	unspecified whole organism ventral region	Fig. 7 from Lu et al., 2017 Fig. 8 from Rui et al., 2007
gata2a	whole organism ventral region	Fig. 7 from Lu et al., 2017
gsc	unspecified whole organism dorsal region	Fig. 7 from Lu et al., 2017 Fig. 8 from Rui et al., 2007
hoxb1b	(not) neural plate	Fig. 5 from Xiong et al., 2006
otx2b	(not) neuroectoderm whole organism dorsal region	Fig. 7 from Lu et al., 2017 Fig. 5 from Xiong et al., 2006
tob1a	germ ring	Fig. 1 from Xiong et al., 2006

Phenotype

Phenotype resulting from MO3-ctnnb2

Phenotype	Fish	Figures
anatomical structure dharma expression decreased distribution, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017
dorsal/ventral pattern formation disrupted, abnormal	WT + MO3-ctnnb2	Fig. 8 from Rui et al., 2007
embryo development paedomorphic growth, abnormal	TU + MO3-ctnnb2	Fig. 1 from Xiong et al., 2006
whole organism ventralized, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017
whole organism wholly ventralized, abnormal	WT + MO3-ctnnb2	Fig. 8 from Rui et al., 2007
whole organism dorsal region gsc expression decreased distribution, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017
whole organism dorsal region otx2b expression decreased distribution, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017
whole organism ventral region eve1 expression increased distribution, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017
whole organism ventral region gata2a expression increased distribution, abnormal	AB + MO3-ctnnb2	Fig. 7 from Lu et al., 2017

Phenotype of all Fish created by or utilizing MO3-ctnnb2

Phenotype	Fish	Conditions	Figures
whole organism ventral region eve1 expression increased distribution, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
whole organism ventral region gata2a expression increased distribution, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
anatomical structure dharma expression decreased distribution, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
whole organism dorsal region gsc expression decreased distribution, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
whole organism dorsal region otx2b expression decreased distribution, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
whole organism ventralized, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal	AB + MO3-ctnnb2	standard conditions	Fig. 7 from Lu et al., 2017
embryo development paedomorphic growth, abnormal	TU + MO3-ctnnb2	standard conditions	Fig. 1 from Xiong et al., 2006
dorsal/ventral pattern formation disrupted, abnormal	WT + MO3-ctnnb2	standard conditions	Fig. 8 from Rui et al., 2007
whole organism wholly ventralized, abnormal	WT + MO3-ctnnb2	standard conditions	Fig. 8 from Rui et al., 2007

Citations