Morpholino
MO1-wt1b
- ID
- ZDB-MRPHLNO-071107-3
- Name
- MO1-wt1b
- Previous Names
-
- wt1b-splice1-1 (1)
- Target
- Sequence
-
5' - GGATGGTTTTCTCACCCTGGTTGCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wt1b
Expressed Gene | Anatomy | Figures |
---|---|---|
mafba |
|
Fig. 5
from Dong et al., 2015 |
magi2a |
|
Fig. 5
from Dong et al., 2015 |
nphs1 |
Fig. 4 ![]() |
|
nphs2 |
Fig. 5
from Dong et al., 2015 Fig. 4 ![]() |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-wt1b
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-wt1b
1 - 5 of 13 Show all
Citations
- Dong, L., Pietsch, S., Tan, Z., Perner, B., Sierig, R., Kruspe, D., Groth, M., Witzgall, R., Gröne, H., Platzer, M., Englert, C. (2015) Integration of Cistromic and Transcriptomic Analyses Identifies Nphs2, Mafb, and Magi2 as Wilms' Tumor 1 Target Genes in Podocyte Differentiation and Maintenance. Journal of the American Society of Nephrology : JASN. 26(9):2118-28
- Perner, B., Englert, C., and Bollig, F. (2007) The Wilms tumor genes wt1a and wt1b control different steps during formation of the zebrafish pronephros. Developmental Biology. 309(1):87-96
1 - 2 of 2
Show