Morpholino

MO3-rx3

ID

ZDB-MRPHLNO-071102-1

Name

MO3-rx3

Previous Names

None

Target

rx3 (1)

Sequence

5' - GTGTCTCTCACCTGTACTCGGACTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-rx3

No data available

Phenotype

Phenotype resulting from MO3-rx3

No data available

Phenotype of all Fish created by or utilizing MO3-rx3

Phenotype	Fish	Conditions	Figures
hypothalamus rx3 expression spatial pattern, abnormal	WT + MO1-rx3 + MO3-rx3	control	Fig. 7 from Muthu et al., 2016
hypothalamus ab4-h3 labeling amount, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus pomca expression amount, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus nkx2.1 expression spatial pattern, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus pomca expression absent, abnormal	WT + MO1-rx3 + MO3-rx3	control	Fig. 7 from Muthu et al., 2016
hypothalamus nkx2.1 expression spatial pattern, abnormal	WT + MO1-rx3 + MO3-rx3	control	Fig. 7 from Muthu et al., 2016
hypothalamus etv4 expression increased amount, abnormal	WT + MO1-rx3 + MO3-rx3	standard conditions	Fig. 5 from Muthu et al., 2016
hypothalamus mitotic cell cycle process increased occurrence, abnormal	WT + MO1-rx3 + MO3-rx3	standard conditions	Fig. 6 , Fig. 7 from Muthu et al., 2016
hypothalamus shha expression decreased amount, abnormal	WT + MO1-rx3 + MO3-rx3	standard conditions	Fig. 6 from Muthu et al., 2016
hypothalamus nr5a1a expression amount, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus mitotic cell cycle process occurrence, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus rx3 expression spatial pattern, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus ptch2 expression spatial pattern, abnormal	WT + MO1-rx3 + MO3-rx3	control	Fig. 7 from Muthu et al., 2016
hypothalamus ab4-h3 labeling increased amount, abnormal	WT + MO1-rx3 + MO3-rx3	standard conditions	Fig. 6 , Fig. 7 from Muthu et al., 2016
hypothalamus ptch2 expression spatial pattern, ameliorated	WT + MO1-rx3 + MO3-rx3	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus nr5a1a expression absent, abnormal	WT + MO1-rx3 + MO3-rx3	control	Fig. 7 from Muthu et al., 2016
eye aplastic, abnormal	WT + MO1-rx3 + MO3-rx3	standard conditions	Fig. 6 from Tessmar-Raible et al., 2007

Citations