Morpholino

MO1-epoa

ID

ZDB-MRPHLNO-070921-1

Name

MO1-epoa

Previous Names

MO1-epo

Target

epoa (1)

Sequence

5' - TGAAACATTCGCAAAACAACTTGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-epoa

Expressed Gene	Anatomy	Figures
gata1a	intermediate cell mass of mesoderm	Fig. 4 from Chu et al., 2007
hbaa1	intermediate cell mass of mesoderm	Fig. 4 from Chu et al., 2007
hbba1	intermediate cell mass of mesoderm	Fig. 4 from Chu et al., 2007
hbbe1.1	intermediate cell mass of mesoderm	Fig. 4 from Chu et al., 2007
nphs2	whole organism	Fig. 3 from She et al., 2017
tal1	intermediate cell mass of mesoderm	Fig. 4 from Chu et al., 2007

Phenotype

Phenotype resulting from MO1-epoa

Phenotype	Fish	Figures
nucleate erythrocyte decreased amount, abnormal	li1Tg + MO1-epoa	Fig. 3 from She et al., 2017
nucleate erythrocyte hemoglobin complex decreased amount, abnormal	WT + MO1-epoa	Fig. 4 from Chu et al., 2007
pericardium edematous, abnormal	WT + MO1-epoa	Fig. 4 from Chu et al., 2007
pronephric duct decreased length, abnormal	li1Tg + MO1-epoa	Fig. 5 from She et al., 2019
pronephric glomerulus increased size, abnormal	li1Tg + MO1-epoa	Fig. 3 , Fig. 6 from She et al., 2017
pronephric glomerulus apoptotic process increased occurrence, abnormal	li1Tg + MO1-epoa	Fig. 5 from She et al., 2017
pronephric tubule decreased length, abnormal	li1Tg + MO1-epoa	Fig. 3 , Fig. 6 from She et al., 2017
pronephros decreased functionality, abnormal	li1Tg + MO1-epoa	Fig. 3 from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal	li1Tg + MO1-epoa	Fig. 5 from She et al., 2017
renal glomerulus increased size, abnormal	li1Tg + MO1-epoa	Fig. 5 from She et al., 2019
whole organism lethal (sensu genetics), abnormal	WT + MO1-epoa	Fig. 4 from Chu et al., 2007

Phenotype of all Fish created by or utilizing MO1-epoa

Phenotype	Fish	Conditions	Figures
whole organism lethal (sensu genetics), abnormal	WT + MO1-epoa	standard conditions	Fig. 4 from Chu et al., 2007
nucleate erythrocyte hemoglobin complex decreased amount, abnormal	WT + MO1-epoa	standard conditions	Fig. 4 from Chu et al., 2007
pericardium edematous, abnormal	WT + MO1-epoa	standard conditions	Fig. 4 from Chu et al., 2007
nucleate erythrocyte decreased amount, abnormal	li1Tg + MO1-epoa	control	Fig. 3 from She et al., 2017
pronephric tubule length, ameliorated	li1Tg + MO1-epoa	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 6 from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal	li1Tg + MO1-epoa	control	Fig. 5 from She et al., 2017
pronephric tubule decreased length, abnormal	li1Tg + MO1-epoa	control	Fig. 3 , Fig. 6 from She et al., 2017
pronephros functionality, ameliorated	li1Tg + MO1-epoa	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 6 from She et al., 2017
pronephric duct decreased length, abnormal	li1Tg + MO1-epoa	standard conditions	Fig. 5 from She et al., 2019
pronephric glomerulus apoptotic process increased occurrence, abnormal	li1Tg + MO1-epoa	control	Fig. 5 from She et al., 2017
renal glomerulus increased size, abnormal	li1Tg + MO1-epoa	standard conditions	Fig. 5 from She et al., 2019
pronephric glomerulus size, ameliorated	li1Tg + MO1-epoa	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 6 from She et al., 2017
pronephros decreased functionality, abnormal	li1Tg + MO1-epoa	control	Fig. 3 from She et al., 2017
pronephric glomerulus increased size, abnormal	li1Tg + MO1-epoa	control	Fig. 3 , Fig. 6 from She et al., 2017
pronephric tubule decreased length, exacerbated	li1Tg + MO1-epoa + MO1-pdx1	control	Fig. 7 from She et al., 2017
pronephric glomerulus increased size, exacerbated	li1Tg + MO1-epoa + MO1-pdx1	control	Fig. 7 from She et al., 2017
pronephros renal filtration occurrence, ameliorated	li1Tg + MO1-epoa + MO1-pdx1	control	Fig. 7 from She et al., 2017

Citations