Morpholino

MO3-bmp4

ID

ZDB-MRPHLNO-070710-1

Name

MO3-bmp4

Previous Names

None

Target

bmp4 (1)

Sequence

5' - GGTGTTTGATTGTCTGACCTTCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

e1-e2 splice blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-bmp4

Expressed Gene	Anatomy	Figures
admp	axial chorda mesoderm	Fig. 2 from Esterberg et al., 2008
col2a1a	(not) floor plate	Fig. 5 from Esterberg et al., 2008
foxa3	gut liver pancreas	Fig. 6 from Chocron et al., 2007
gsc	prechordal plate	Fig. 2 from Esterberg et al., 2008
has2	atrioventricular canal atrium	Fig. 4 from Grassini et al., 2018
ihhb	notochord posterior region	Fig. 5 from Esterberg et al., 2008
lft1	(not) heart rudiment	Fig. 6 from Chocron et al., 2007
myl7	heart tube	Fig. 6 from Chocron et al., 2007
ndr2	lateral plate mesoderm	Fig. 6 from Chocron et al., 2007
noto	axial chorda mesoderm	Fig. 2 from Esterberg et al., 2008
pitx2	(not) lateral plate mesoderm	Fig. 6 from Chocron et al., 2007
ptch2	(not) post-vent region (not) trunk	Fig. 5 from Esterberg et al., 2008
shha	chordo neural hinge diencephalon floor plate notochord	Fig. 3 , Fig. 5 from Esterberg et al., 2008
spaw	lateral plate mesoderm	Fig. 6 from Chocron et al., 2007
tbxta	axial chorda mesoderm chordo neural hinge notochord	Fig. 2 , Fig. 3 from Esterberg et al., 2008 Fig. 6 from Chocron et al., 2007

Phenotype

Phenotype resulting from MO3-bmp4

Phenotype	Fish	Figures
atrium position, abnormal	WT + MO3-bmp4	Fig. 6 from Chocron et al., 2007
axial chorda mesoderm decreased size, abnormal	WT + MO3-bmp4	Fig. 2 from Esterberg et al., 2008
cell population proliferation disrupted, abnormal	WT + MO3-bmp4	Fig. 4 from Esterberg et al., 2008
chordo neural hinge decreased size, abnormal	WT + MO3-bmp4	Fig. 3 from Esterberg et al., 2008
determination of left/right symmetry process quality, abnormal	WT + MO3-bmp4	Fig. 6 from Chocron et al., 2007
gut decreased curvature, abnormal	WT + MO3-bmp4	Fig. 6 from Chocron et al., 2007
liver duplicated, abnormal	WT + MO3-bmp4	Fig. 6 from Chocron et al., 2007
notochord decreased diameter, abnormal	WT + MO3-bmp4	Fig. 3 from Esterberg et al., 2008
notochord cell decreased amount, abnormal	WT + MO3-bmp4	Fig. 3 from Esterberg et al., 2008
notochord cell vacuolated, abnormal	WT + MO3-bmp4	Fig. 6 from Esterberg et al., 2008
notochord development disrupted, abnormal	WT + MO3-bmp4	Fig. 3 , Fig. 4 from Esterberg et al., 2008
notochord development peramorphic growth, abnormal	WT + MO3-bmp4	Fig. 5 , Fig. 6 from Esterberg et al., 2008
pancreas duplicated, abnormal	WT + MO3-bmp4	Fig. 6 from Chocron et al., 2007
whole organism wholly dorsalized, abnormal	WT + MO3-bmp4	Fig. 5 from Chocron et al., 2007

Phenotype of all Fish created by or utilizing MO3-bmp4

Phenotype	Fish	Conditions	Figures
caudal fin decreased size, abnormal	WT + MO1-bmp4 + MO3-bmp4	standard conditions	Fig. S2 from Smith et al., 2008
whole organism wholly dorsalized, abnormal	WT + MO3-bmp4	standard conditions	Fig. 5 from Chocron et al., 2007
liver duplicated, abnormal	WT + MO3-bmp4	standard conditions	Fig. 6 from Chocron et al., 2007
gut decreased curvature, abnormal	WT + MO3-bmp4	standard conditions	Fig. 6 from Chocron et al., 2007
notochord development disrupted, abnormal	WT + MO3-bmp4	standard conditions	Fig. 3 , Fig. 4 from Esterberg et al., 2008
atrium position, abnormal	WT + MO3-bmp4	standard conditions	Fig. 6 from Chocron et al., 2007
notochord development peramorphic growth, abnormal	WT + MO3-bmp4	standard conditions	Fig. 5 , Fig. 6 from Esterberg et al., 2008
determination of left/right symmetry process quality, abnormal	WT + MO3-bmp4	standard conditions	Fig. 6 from Chocron et al., 2007
notochord cell decreased amount, abnormal	WT + MO3-bmp4	standard conditions	Fig. 3 from Esterberg et al., 2008
notochord cell vacuolated, abnormal	WT + MO3-bmp4	standard conditions	Fig. 6 from Esterberg et al., 2008
cell population proliferation disrupted, abnormal	WT + MO3-bmp4	standard conditions	Fig. 4 from Esterberg et al., 2008
notochord decreased diameter, abnormal	WT + MO3-bmp4	standard conditions	Fig. 3 from Esterberg et al., 2008
axial chorda mesoderm decreased size, abnormal	WT + MO3-bmp4	standard conditions	Fig. 2 from Esterberg et al., 2008
chordo neural hinge decreased size, abnormal	WT + MO3-bmp4	standard conditions	Fig. 3 from Esterberg et al., 2008
pancreas duplicated, abnormal	WT + MO3-bmp4	standard conditions	Fig. 6 from Chocron et al., 2007
heart looping disrupted, abnormal	WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4	standard conditions	Fig. S2 from Smith et al., 2008
pericardium edematous, abnormal	WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4	standard conditions	Fig. S2 from Smith et al., 2008
caudal fin decreased size, abnormal	WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4	standard conditions	Fig. S2 from Smith et al., 2008
axial chorda mesoderm decreased size, abnormal	WT + MO2-fstl1a + MO3-bmp4 + MO4-fstl1b	standard conditions	Fig. 2 from Esterberg et al., 2008
heart rudiment cardioblast anterior-lateral migration process quality, abnormal	twu34Tg + MO3-bmp4 + MO3-spaw	standard conditions	Fig. 1 from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal	twu34Tg + MO3-bmp4 + MO3-spaw	standard conditions	Fig. 1 from Lenhart et al., 2013
presumptive endocardium heart development decreased process quality, abnormal	twu34Tg + MO3-bmp4 + MO3-spaw	standard conditions	Fig. 3 from Lenhart et al., 2013
atrioventricular canal development process quality, ameliorated	nppa^{uq19ks/uq19ks}; nppb^{uq20ks/uq20ks} + MO3-bmp4	standard conditions	Fig. 4 from Grassini et al., 2018
atrium has2 expression position, ameliorated	nppa^{uq19ks/uq19ks}; nppb^{uq20ks/uq20ks} + MO3-bmp4	standard conditions	Fig. 4 from Grassini et al., 2018
atrium has2 expression spatial pattern, ameliorated	nppa^{uq19ks/uq19ks}; nppb^{uq20ks/uq20ks} + MO3-bmp4	standard conditions	Fig. 4 from Grassini et al., 2018
atrium cardiac jelly thickness, ameliorated	nppa^{uq19ks/uq19ks}; nppb^{uq20ks/uq20ks}; uq25bhTg + MO3-bmp4	standard conditions	Fig. 4 from Grassini et al., 2018
atrium cardiac jelly development process quality, ameliorated	nppa^{uq19ks/uq19ks}; nppb^{uq20ks/uq20ks}; uq25bhTg + MO3-bmp4	standard conditions	Fig. 4 from Grassini et al., 2018

Citations