Morpholino

MO3-myf5

ID
ZDB-MRPHLNO-070706-1
Name
MO3-myf5
Previous Names
  • myf5-MO2 (1)
Target
Sequence
5' - GATCTGGGATGTGGAGAATACGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-myf5
Phenotype
Phenotype resulting from MO3-myf5
Phenotype Fish Figures
ceratobranchial cartilage absent, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 4 from Lin et al., 2013
palatoquadrate cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 2 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 2 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 2 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 5 from Lin et al., 2013
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO3-myf5 + MO4-tp53 Fig. 4 from Lin et al., 2013
Phenotype of all Fish created by or utilizing MO3-myf5
Phenotype Fish Conditions Figures
palatoquadrate cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 3 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
presumptive cephalic mesoderm gene expression disrupted, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
neuroectoderm neural crest cell decreased amount, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 4 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 6 has fewer parts of type cranial neural crest, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 5 has fewer parts of type chondroblast, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
Meckel's cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
pharyngeal arch 6 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
pharyngeal arch 5 absent, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 2 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO3-myf5 + MO4-tp53 standard conditions Fig. 5 from Lin et al., 2013
skeletal muscle tissue development delayed, abnormal shhatbx392/tbx392 + MO3-myf5 standard conditions Fig. 2 with image from Osborn et al., 2011
skeletal muscle fiber development disrupted, abnormal WIK/AB + MO3-myf5 + MO5-myf5 + MO7-myod1 + MO8-myod1 standard conditions Fig. 4 with image from Maves et al., 2007
ceratohyal cartilage chondrocyte decreased size, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 3 with image from Shwartz et al., 2012
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 1 with image from Shwartz et al., 2012
somite nucleus apoptotic, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 7 with image from Hammond et al., 2007
fast muscle cell muscle cell development decreased process quality, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 4 with image from Nord et al., 2013
ceratohyal cartilage decreased length, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 1 with image from Shwartz et al., 2012
slow muscle cell muscle cell development decreased process quality, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 4 with image from Nord et al., 2013
chondrocyte stacked, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 3 with image from Shwartz et al., 2012
ceratohyal cartilage chondrocyte morphology, abnormal WT + MO1-myod1 + MO3-myf5 standard conditions Fig. 3 with image from Shwartz et al., 2012
Citations