Morpholino
MO4-apex1
- ID
- ZDB-MRPHLNO-070619-4
- Name
- MO4-apex1
- Previous Names
-
- TS-MO (1)
- Target
- Sequence
-
5' - GTTCTTCTTGGCTCTTTTGGGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-apex1
No data available
Phenotype
Phenotype resulting from MO4-apex1
1 - 5 of 25 Show all
Phenotype of all Fish created by or utilizing MO4-apex1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
forebrain otx2b expression decreased amount, abnormal | WT + MO4-apex1 | control |
Fig. 3 ![]() |
yolk syncytial layer nitric oxide increased amount, abnormal | WT + MO4-apex1 | control |
Fig. 1 ![]() |
whole organism egr2a expression decreased amount, abnormal | WT + MO4-apex1 | control |
Fig. 4 ![]() |
hindbrain pax2a expression absent, abnormal | WT + MO4-apex1 | control |
Fig. 3 ![]() |
whole organism mdm2 expression increased amount, abnormal | WT + MO4-apex1 | control |
Fig. 4 ![]() |
1 - 5 of 40 Show all
Citations
- Pei, D.S., Jia, P.P., Luo, J.J., Liu, W., Strauss, P.R. (2019) AP endonuclease 1 (Apex1) influences brain development linking oxidative stress and DNA repair. Cell Death & Disease. 10:348
- Pei, D.S., Yang, X.J., Liu, W., Guikema, J.E., Schrader, C.E., and Strauss, P.R. (2011) A novel regulatory circuit in base excision repair involving AP endonuclease 1, Creb1 and DNA polymerase beta. Nucleic acids research. 39(8):3156-3165
- Fortier, S., Yang, X., Wang, Y., Bennett, R.A., and Strauss, P.R. (2009) Base Excision Repair in Early Zebrafish Development: Evidence for DNA Polymerase Switching and Standby AP endonuclease Activity. Biochemistry. 48(23):5396-5404
- Wang, Y., Shupenko, C.C., Melo, L.F., and Strauss, P.R. (2006) DNA Repair Protein Involved in Heart and Blood Development. Molecular and cellular biology. 26(23):9083-9093
1 - 4 of 4
Show