Morpholino

MO4-apex1

ID
ZDB-MRPHLNO-070619-4
Name
MO4-apex1
Previous Names
  • TS-MO (1)
Target
Sequence
5' - GTTCTTCTTGGCTCTTTTGGGCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-apex1
Expressed Gene Anatomy Figures
apex1 Fig. 1 with image,  Fig. 4 with image from Pei et al., 2019
Fig. 3,  Fig. 4,  Fig. 5,  Fig. 6 from Pei et al., 2011
cdkn1a Fig. 4 with image from Pei et al., 2019
creb1a Fig. 4 with image from Pei et al., 2019
Fig. 3,  Fig. 4,  Fig. 6 from Pei et al., 2011
crebbpb Fig. 5 from Pei et al., 2011
crema Fig. 5 from Pei et al., 2011
crtc1b Fig. 5 from Pei et al., 2011
crtc3 Fig. 5 from Pei et al., 2011
egr2a Fig. 3 with image,  Fig. 4 with image from Pei et al., 2019
fezf2 Fig. 3 with image from Pei et al., 2019
mdm2 Fig. 4 with image from Pei et al., 2019
ogg1 Fig. 4 with image from Pei et al., 2019
otx2b Fig. 3 with image from Pei et al., 2019
pax2a Fig. 3 with image from Pei et al., 2019
polb Fig. 4 with image from Pei et al., 2019
Fig. 3 from Pei et al., 2011
tp53 Fig. 4 with image from Pei et al., 2019
Phenotype
Phenotype resulting from MO4-apex1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO4-apex1 Fig. 4 from Wang et al., 2006
brain morphology, abnormal WT + MO4-apex1 Fig. 2 with image from Pei et al., 2019
cell death increased occurrence, abnormal twu34Tg + MO4-apex1 Fig. 4,  Fig. 6 from Wang et al., 2006
eye decreased size, abnormal WT + MO4-apex1 Fig. 3 with image from Pei et al., 2019
forebrain fezf2 expression decreased amount, abnormal WT + MO4-apex1 Fig. 3 with image from Pei et al., 2019
forebrain otx2b expression decreased amount, abnormal WT + MO4-apex1 Fig. 3 with image from Pei et al., 2019
forebrain increased size, abnormal WT + MO4-apex1 Fig. 2 with image,  Fig. 3 with image from Pei et al., 2019
forebrain morphology, abnormal WT + MO4-apex1 Fig. 2 with image from Pei et al., 2019
heart looping disrupted, abnormal twu34Tg + MO4-apex1 Fig. 6 from Wang et al., 2006
hindbrain pax2a expression absent, abnormal WT + MO4-apex1 Fig. 3 with image from Pei et al., 2019
positive regulation of gene expression disrupted, abnormal WT + MO4-apex1 Fig. 3,  Fig. 5 from Pei et al., 2011
rhombomere 5 egr2a expression decreased amount, abnormal WT + MO4-apex1 Fig. 3 with image from Pei et al., 2019
ventricular system morphology, abnormal WT + MO4-apex1 Fig. 2 with image from Pei et al., 2019
whole organism apex1 expression decreased amount, abnormal WT + MO4-apex1 Fig. 1 with image,  Fig. 4 with image from Pei et al., 2019
whole organism egr2a expression decreased amount, abnormal WT + MO4-apex1 Fig. 4 with image from Pei et al., 2019
whole organism ogg1 expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism creb1a expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism polb expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism decreased life span, abnormal WT + MO4-apex1 Fig. S4 from Pei et al., 2019
whole organism mdm2 expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 Fig. 4 with image from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-apex1 Fig. 4 with image from Pei et al., 2019
whole organism lethal (sensu genetics), abnormal WT + MO4-apex1 Fig. 6 from Wang et al., 2006
whole organism reactive oxygen species increased amount, abnormal WT + MO4-apex1 Fig. 1 with image from Pei et al., 2019
yolk syncytial layer nitric oxide increased amount, abnormal WT + MO4-apex1 Fig. 1 with image from Pei et al., 2019
Phenotype of all Fish created by or utilizing MO4-apex1
Phenotype Fish Conditions Figures
forebrain otx2b expression decreased amount, abnormal WT + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
yolk syncytial layer nitric oxide increased amount, abnormal WT + MO4-apex1 control Fig. 1 with image from Pei et al., 2019
whole organism egr2a expression decreased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
hindbrain pax2a expression absent, abnormal WT + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
whole organism mdm2 expression increased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
whole organism decreased life span, abnormal WT + MO4-apex1 control Fig. S4 from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
forebrain increased size, abnormal WT + MO4-apex1 control Fig. 2 with image,  Fig. 3 with image from Pei et al., 2019
cell death increased occurrence, abnormal WT + MO4-apex1 standard conditions Fig. 4 from Wang et al., 2006
whole organism polb expression decreased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
ventricular system morphology, abnormal WT + MO4-apex1 control Fig. 2 with image from Pei et al., 2019
brain morphology, abnormal WT + MO4-apex1 control Fig. 2 with image from Pei et al., 2019
positive regulation of gene expression disrupted, abnormal WT + MO4-apex1 standard conditions Fig. 3,  Fig. 5 from Pei et al., 2011
eye decreased size, abnormal WT + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
whole organism ogg1 expression decreased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
whole organism creb1a expression decreased amount, abnormal WT + MO4-apex1 control Fig. 4 with image from Pei et al., 2019
whole organism apex1 expression decreased amount, abnormal WT + MO4-apex1 control Fig. 1 with image,  Fig. 4 with image from Pei et al., 2019
forebrain morphology, abnormal WT + MO4-apex1 control Fig. 2 with image from Pei et al., 2019
whole organism lethal (sensu genetics), abnormal WT + MO4-apex1 standard conditions Fig. 6 from Wang et al., 2006
apoptotic process increased occurrence, abnormal WT + MO4-apex1 standard conditions Fig. 4 from Wang et al., 2006
whole organism reactive oxygen species increased amount, abnormal WT + MO4-apex1 control Fig. 1 with image from Pei et al., 2019
forebrain fezf2 expression decreased amount, abnormal WT + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
rhombomere 5 egr2a expression decreased amount, abnormal WT + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
whole organism creb1a expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism apex1 expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism polb expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism cdkn1a expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism egr2a expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism mdm2 expression increased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
whole organism ogg1 expression decreased amount, abnormal WT + MO4-apex1 + MO4-tp53 control Fig. 4 with image from Pei et al., 2019
cell death increased occurrence, abnormal twu34Tg + MO4-apex1 standard conditions Fig. 6 from Wang et al., 2006
heart looping disrupted, abnormal twu34Tg + MO4-apex1 standard conditions Fig. 6 from Wang et al., 2006
hindbrain pax2a expression absent, abnormal tp53zdf1/zdf1 + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
forebrain increased size, abnormal tp53zdf1/zdf1 + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
forebrain fezf2 expression decreased amount, abnormal tp53zdf1/zdf1 + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
rhombomere 5 egr2a expression decreased amount, abnormal tp53zdf1/zdf1 + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
forebrain otx2b expression decreased amount, abnormal tp53zdf1/zdf1 + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
eye decreased size, abnormal tp53zdf1/zdf1 + MO4-apex1 control Fig. 3 with image from Pei et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.