Morpholino
MO2-pbx4
- ID
- ZDB-MRPHLNO-070529-3
- Name
- MO2-pbx4
- Previous Names
-
- Pbx4MO1 (1)
- Target
- Sequence
-
5' - AATACTTTTGAGCCGAATCTCTCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pbx4
No data available
Phenotype
Phenotype resulting from MO2-pbx4
No data available
Phenotype of all Fish created by or utilizing MO2-pbx4
1 - 5 of 43 Show all
Citations
- Holowiecki, A., Linstrum, K., Ravisankar, P., Chetal, K., Salomonis, N., Waxman, J.S. (2020) Pbx4 limits heart size and fosters arch artery formation through partitioning second heart field progenitors and restricting proliferation. Development (Cambridge, England). 147(5):
- Itoh, T., Takeuchi, M., Sakagami, M., Asakawa, K., Sumiyama, K., Kawakami, K., Shimizu, T., Hibi, M. (2020) Gsx2 is required for specification of neurons in the inferior olivary nuclei from Ptf1a-expressing neural progenitors in zebrafish. Development (Cambridge, England). 147(19):
- Selland, L.G., Koch, S., Laraque, M., Waskiewicz, A.J. (2018) Coordinate regulation of retinoic acid synthesis by pbx genes and fibroblast growth factor signaling by hoxb1b is required for hindbrain patterning and development. Mechanisms of Development. 150:28-41
- Choe, S.K., Ladam, F., and Sagerström, C.G. (2014) TALE factors poise promoters for activation by Hox proteins. Developmental Cell. 28(2):203-211
- Zigman, M., Laumann-Lipp, N., Titus, T., Postlethwait, J., and Moens, C.B. (2014) Hoxb1b controls oriented cell division, cell shape and microtubule dynamics in neural tube morphogenesis. Development (Cambridge, England). 141(3):639-649
- Yao, Z., Farr, G.H., Tapscott, S.J., and Maves, L. (2013) Pbx and Prdm1a transcription factors differentially regulate subsets of the fast skeletal muscle program in zebrafish. Biology Open. 2(6):546-555
- Erickson, T., Pillay, L.M., and Waskiewicz, A.J. (2011) Zebrafish Tshz3b negatively regulates Hox function in the developing hindbrain. Genesis (New York, N.Y. : 2000). 49(9):725-42
- Lukowski, C.M., Drummond, D.L., and Waskiewicz, A.J. (2011) Pbx-dependent regulation of lbx gene expression in developing zebrafish embryos. Genome. 54(12):973-85
- Pillay, L.M., Forrester, A.M., Erickson, T., Berman, J.N., and Waskiewicz, A.J. (2010) The Hox cofactors Meis1 and Pbx act upstream of gata1 to regulate primitive hematopoiesis. Developmental Biology. 340(2):306-317
- Maves, L., Tyler, A., Moens, C.B., and Tapscott, S.J. (2009) Pbx acts with Hand2 in early myocardial differentiation. Developmental Biology. 333(2):409-418
1 - 10 of 13
Show