Morpholino

MO1-glra4a

ID
ZDB-MRPHLNO-060706-1
Name
MO1-glra4a
Previous Names
  • Glr-MO (1)
  • GlyRa2 AMO (1)
Target
Sequence
5' - TGATAATGAGAGAGAAATGCGTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-glra4a
Expressed Gene Anatomy Figures
atf4b Fig. 5 from Samarut et al., 2016
atf7a Fig. 5 from Samarut et al., 2016
atf7ip Fig. 5 from Samarut et al., 2016
bmp2b Fig. 5 from Samarut et al., 2016
bmp6 Fig. 5 from Samarut et al., 2016
cacna2d4b Fig. 5 from Samarut et al., 2016
camk4 Fig. 5 from Samarut et al., 2016
dkk1b Fig. 5 from Samarut et al., 2016
fosl1a Fig. 5 from Samarut et al., 2016
gfap Fig. 3 with image from Bekri et al., 2018
her4.1 Fig. 2 from Bekri et al., 2019
itpr1b Fig. 5 from Samarut et al., 2016
lnx1 Fig. 1 from Bekri et al., 2019
nes Fig. 4 with image from Bekri et al., 2018
numbl Fig. 2 from Bekri et al., 2019
shhb Fig. 5 from Samarut et al., 2016
smad3a Fig. 5 from Samarut et al., 2016
tp53 Fig. 5 from Samarut et al., 2016
wif1 Fig. 5 from Samarut et al., 2016
Phenotype
Phenotype resulting from MO1-glra4a
Phenotype Fish Figures
brain ab1-casp3 labeling increased amount, abnormal WT + MO1-glra4a Fig. 1 with image from Bekri et al., 2018
brain apoptotic process increased occurrence, abnormal WT + MO1-glra4a Fig. 1 with image from Bekri et al., 2018
brain apoptotic process occurrence, ameliorated WT + MO1-glra4a + MO4-tp53 Fig. 1 with image from Bekri et al., 2018
brain neuronal stem cell nes expression decreased amount, abnormal WT + MO1-glra4a Fig. 4 with image from Bekri et al., 2018
cellular response to mechanical stimulus disrupted, abnormal WT + MO1-glra4a Fig. 2 with image from McDearmid et al., 2006
central nervous system lnx1 expression increased amount, abnormal WT + MO1-glra4a Fig. 1 from Bekri et al., 2019
central nervous system neuron differentiation disrupted, abnormal WT + MO1-glra4a Fig. 4 with image from McDearmid et al., 2006
CiA decreased amount, abnormal WT + MO1-glra4a Fig. 1 from Côté et al., 2012
motor neuron decreased functionality, abnormal WT + MO1-glra4a Fig. 1 with image from McDearmid et al., 2006
neural tube nes expression decreased amount, abnormal WT + MO1-glra4a Fig. 4 with image from Bekri et al., 2018
neuronal stem cell atf4b expression decreased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell atf7a expression decreased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell atf7ip expression decreased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell smad3a expression decreased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell bmp6 expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell bmp2b expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell camk4 expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell fosl1a expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell dkk1b expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell shhb expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell wif1 expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell lnx1 expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 1 from Bekri et al., 2019
neuronal stem cell her4.1 expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 2 from Bekri et al., 2019
neuronal stem cell itpr1b expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell cacna2d4b expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
neuronal stem cell tp53 expression increased amount, abnormal mi2001Tg + MO1-glra4a Fig. 5 from Samarut et al., 2016
otic placode nes expression absent, abnormal WT + MO1-glra4a Fig. 4 with image from Bekri et al., 2018
spinal cord GFP expression decreased amount, abnormal nns6Tg; udm101Tg; zf168Tg + MO1-glra4a Fig. 4 with image from Bekri et al., 2018
spinal cord GFP expression decreased distribution, abnormal nns6Tg; udm101Tg; zf168Tg + MO1-glra4a Fig. 4 with image from Bekri et al., 2018
spinal cord ab1-casp3 labeling increased amount, abnormal WT + MO1-glra4a Fig. 1 with image from Bekri et al., 2018
spinal cord apoptotic process increased occurrence, abnormal WT + MO1-glra4a Fig. 1 with image from Bekri et al., 2018
spinal cord apoptotic process occurrence, ameliorated WT + MO1-glra4a + MO4-tp53 Fig. 1 with image from Bekri et al., 2018
spinal cord motor neuron decreased functionality, abnormal WT + MO1-glra4a Fig. 2 with image from McDearmid et al., 2006
spinal cord neuronal stem cell nes expression decreased amount, abnormal WT + MO1-glra4a Fig. 4 with image from Bekri et al., 2018
spinal cord interneuron decreased amount, abnormal WT + MO1-glra4a Fig. 3 with image from McDearmid et al., 2006
spinal cord interneuron GABAergic neuron decreased amount, abnormal WT + MO1-glra4a Fig. 1 from Côté et al., 2012
spinal cord interneuron glutamatergic neuron decreased amount, abnormal nns1Tg + MO1-glra4a Fig. 1 from Côté et al., 2012
spinal cord interneuron glycinergic neuron decreased amount, abnormal WT + MO1-glra4a Fig. 1 from Côté et al., 2012
spinal cord neural tube ab1-casp3 labeling increased amount, abnormal WT + MO1-glra4a Fig. 1 with image from Bekri et al., 2018
synaptic transmission, glycinergic arrested, abnormal WT + MO1-glra4a Fig. 1 with image from McDearmid et al., 2006
whole organism Ab1-numb labeling decreased amount, abnormal WT + MO1-glra4a Fig. 2 from Bekri et al., 2019
Phenotype of all Fish created by or utilizing MO1-glra4a
Phenotype Fish Conditions Figures
synaptic transmission, glycinergic arrested, abnormal WT + MO1-glra4a standard conditions Fig. 1 with image from McDearmid et al., 2006
spinal cord neural tube ab1-casp3 labeling increased amount, abnormal WT + MO1-glra4a control Fig. 1 with image from Bekri et al., 2018
whole organism Ab1-numb labeling decreased amount, abnormal WT + MO1-glra4a standard conditions Fig. 2 from Bekri et al., 2019
neural tube nes expression decreased amount, abnormal WT + MO1-glra4a control Fig. 4 with image from Bekri et al., 2018
spinal cord interneuron decreased amount, abnormal WT + MO1-glra4a standard conditions Fig. 3 with image from McDearmid et al., 2006
motor neuron decreased functionality, abnormal WT + MO1-glra4a standard conditions Fig. 1 with image from McDearmid et al., 2006
central nervous system lnx1 expression increased amount, abnormal WT + MO1-glra4a control Fig. 1 from Bekri et al., 2019
spinal cord interneuron glycinergic neuron decreased amount, abnormal WT + MO1-glra4a standard conditions Fig. 1 from Côté et al., 2012
brain apoptotic process increased occurrence, abnormal WT + MO1-glra4a control Fig. 1 with image from Bekri et al., 2018
spinal cord interneuron GABAergic neuron decreased amount, abnormal WT + MO1-glra4a standard conditions Fig. 1 from Côté et al., 2012
CiA decreased amount, abnormal WT + MO1-glra4a standard conditions Fig. 1 from Côté et al., 2012
otic placode nes expression absent, abnormal WT + MO1-glra4a control Fig. 4 with image from Bekri et al., 2018
central nervous system neuron differentiation disrupted, abnormal WT + MO1-glra4a standard conditions Fig. 4 with image from McDearmid et al., 2006
cellular response to mechanical stimulus disrupted, abnormal WT + MO1-glra4a standard conditions Fig. 2 with image from McDearmid et al., 2006
spinal cord neuronal stem cell nes expression decreased amount, abnormal WT + MO1-glra4a control Fig. 4 with image from Bekri et al., 2018
spinal cord apoptotic process increased occurrence, abnormal WT + MO1-glra4a control Fig. 1 with image from Bekri et al., 2018
brain ab1-casp3 labeling increased amount, abnormal WT + MO1-glra4a control Fig. 1 with image from Bekri et al., 2018
brain neuronal stem cell nes expression decreased amount, abnormal WT + MO1-glra4a control Fig. 4 with image from Bekri et al., 2018
spinal cord motor neuron decreased functionality, abnormal WT + MO1-glra4a standard conditions Fig. 2 with image from McDearmid et al., 2006
spinal cord ab1-casp3 labeling increased amount, abnormal WT + MO1-glra4a control Fig. 1 with image from Bekri et al., 2018
brain apoptotic process occurrence, ameliorated WT + MO1-glra4a + MO4-tp53 control Fig. 1 with image from Bekri et al., 2018
spinal cord apoptotic process occurrence, ameliorated WT + MO1-glra4a + MO4-tp53 control Fig. 1 with image from Bekri et al., 2018
neuronal stem cell lnx1 expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 1 from Bekri et al., 2019
neuronal stem cell itpr1b expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell dkk1b expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell atf4b expression decreased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell bmp2b expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell bmp6 expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell tp53 expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell her4.1 expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 2 from Bekri et al., 2019
neuronal stem cell cacna2d4b expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell atf7ip expression decreased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell wif1 expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell camk4 expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell smad3a expression decreased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell atf7a expression decreased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell shhb expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
neuronal stem cell fosl1a expression increased amount, abnormal mi2001Tg + MO1-glra4a standard conditions Fig. 5 from Samarut et al., 2016
spinal cord interneuron glutamatergic neuron decreased amount, abnormal nns1Tg + MO1-glra4a standard conditions Fig. 1 from Côté et al., 2012
spinal cord GFP expression decreased amount, abnormal nns6Tg; udm101Tg; zf168Tg + MO1-glra4a control Fig. 4 with image from Bekri et al., 2018
spinal cord GFP expression decreased distribution, abnormal nns6Tg; udm101Tg; zf168Tg + MO1-glra4a control Fig. 4 with image from Bekri et al., 2018
whole organism Ab1-numb labeling amount, ameliorated WT + MO1-glra4a + MO1-lnx1 standard conditions Fig. 2 from Bekri et al., 2019
spinal cord interneuron decreased amount, abnormal nkuasgfp1aTg; smb1226Tg + MO1-glra4a standard conditions Fig. 1 from Côté et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.