Morpholino

MO2-cdx1a

ID

ZDB-MRPHLNO-060602-1

Name

MO2-cdx1a

Previous Names

None

Target

cdx1a

Sequence

5' - CAGCAGATAGCTCACGGACATTTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This sequence differs by one bp from the published cdx1a sequence AB067733, which may be a polymorphism.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cdx1a

No data available

Phenotype

Phenotype resulting from MO2-cdx1a

No data available

Phenotype of all Fish created by or utilizing MO2-cdx1a

Phenotype	Fish	Conditions	Figures
lateral plate mesoderm tbx5a expression increased distribution, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Lengerke et al., 2011
pronephric glomerulus bilateral, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 , Fig. 7 from Wingert et al., 2007
pronephric podocyte unfused from pronephric podocyte, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 , Fig. 7 from Wingert et al., 2007
posterior pronephric duct aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
corpuscles of Stannius increased size, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment: 4-(diethylamino)benzaldehyde	Fig. 7 from Wingert et al., 2007
podocyte aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment: 4-(diethylamino)benzaldehyde	Fig. 7 from Wingert et al., 2007
pronephric glomerulus dilated, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
corpuscles of Stannius aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 , Fig. 7 from Wingert et al., 2007
pronephric duct opening aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
pronephric glomerulus cystic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
intermediate mesoderm pax2a expression mislocalised, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Lengerke et al., 2011
pronephric proximal straight tubule aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
trunk mesenchyme distended, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
pronephric distal early tubule aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 , Fig. 7 from Wingert et al., 2007
lateral mesoderm myl7 expression amount, ameliorated	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde, chemical treatment by environment: retinoic acid	Fig. 7 from Lengerke et al., 2011
podocyte mislocalised posteriorly, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007
corpuscles of Stannius increased amount, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment: 4-(diethylamino)benzaldehyde	Fig. 7 from Wingert et al., 2007
pronephric distal late tubule aplastic, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 , Fig. 7 from Wingert et al., 2007
lateral plate mesoderm nkx2.5 expression increased distribution, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde	Fig. 6 from Lengerke et al., 2011
intermediate mesoderm pax2a expression decreased amount, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Lengerke et al., 2011
lateral plate mesoderm nkx2.5 expression increased distribution, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment by environment: retinoic acid receptor alpha antagonist	Fig. 6 from Lengerke et al., 2011
pronephric proximal convoluted tubule decreased length, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment: 4-(diethylamino)benzaldehyde	Fig. 7 from Wingert et al., 2007
lateral mesoderm myl7 expression increased amount, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde	Fig. 7 from Lengerke et al., 2011
pericardium edematous, abnormal	cdx4^{tv205c/tv205c} + MO2-cdx1a (TU)	standard conditions	Fig. 5 from Wingert et al., 2007

Citations