header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060118-2
Morpholino Name: MO1-mpp5a
Target: mpp5a (1)
Previous Names: MO1-mpp5, nokMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAGGTCAGCAGCGGCTCCAAACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mpp5a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mpp5a
Expressed Gene Anatomy Figures
myl7 Fig. 1 with image from Rohr et al., 2006
pax2a Fig. 8 with image from Gerlach et al., 2014
podxl Fig. 8 with image from Gerlach et al., 2014
tjp1a Fig. 4 with imageFig. 5 with image from Rohr et al., 2006
wt1a Fig. 8 with image from Gerlach et al., 2014
Fig. 7 with image from Serluca, 2008
PHENOTYPE
Phenotype resulting from MO1-mpp5a
Phenotype of all Fish created by or utilizing MO1-mpp5a
OTHER MO1-mpp5a MORPHOLINO PAGESNo links to external sites
CITATIONS (4)