ZFIN ID: ZDB-MRPHLNO-060109-5
Morpholino Name: MO1-rx3
Target: rx3 (1)
Previous Name: rx3ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGATCCAACAAGCCTCATTGAACG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rx3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rx3 No data available
PHENOTYPE
Phenotype resulting from MO1-rx3
No data available

Phenotype of all Fish created by or utilizing MO1-rx3
Phenotype Fish Conditions Figures
hypothalamus rx3 expression spatial pattern, abnormal WT + MO1-rx3 + MO3-rx3 control Fig. 7 with image from Muthu et al., 2016
hypothalamus ab4-h3 labeling amount, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus pomca expression amount, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus nkx2.1 expression spatial pattern, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus pomca expression absent, abnormal WT + MO1-rx3 + MO3-rx3 control Fig. 7 with image from Muthu et al., 2016
hypothalamus nkx2.1 expression spatial pattern, abnormal WT + MO1-rx3 + MO3-rx3 control Fig. 7 with image from Muthu et al., 2016
hypothalamus etv4 expression increased amount, abnormal WT + MO1-rx3 + MO3-rx3 standard conditions Fig. 5 with image from Muthu et al., 2016
hypothalamus mitotic cell cycle process increased occurrence, abnormal WT + MO1-rx3 + MO3-rx3 standard conditions Fig. 6 with imageFig. 7 with image from Muthu et al., 2016
hypothalamus shha expression decreased amount, abnormal WT + MO1-rx3 + MO3-rx3 standard conditions Fig. 6 with image from Muthu et al., 2016
hypothalamus nr5a1a expression amount, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus mitotic cell cycle process occurrence, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus rx3 expression spatial pattern, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus ptch2 expression spatial pattern, abnormal WT + MO1-rx3 + MO3-rx3 control Fig. 7 with image from Muthu et al., 2016
hypothalamus ab4-h3 labeling increased amount, abnormal WT + MO1-rx3 + MO3-rx3 standard conditions Fig. 6 with imageFig. 7 with image from Muthu et al., 2016
hypothalamus ptch2 expression spatial pattern, ameliorated WT + MO1-rx3 + MO3-rx3 chemical treatment: SMO receptor agonist Fig. 7 with image from Muthu et al., 2016
hypothalamus nr5a1a expression absent, abnormal WT + MO1-rx3 + MO3-rx3 control Fig. 7 with image from Muthu et al., 2016
eye aplastic, abnormal WT + MO1-rx3 + MO3-rx3 standard conditions Fig. 6 with image from Tessmar-Raible et al., 2007
Genome Resources:
CITATIONS (3)