Morpholino

MO6-tal1

ID
ZDB-MRPHLNO-051221-9
Name
MO6-tal1
Previous Names
  • scl ex 3 (1)
Target
Sequence
5' - TAAAATGCTCTTACCATCGTTGATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-tal1
Phenotype
Phenotype resulting from MO6-tal1
No data available
Phenotype of all Fish created by or utilizing MO6-tal1
Phenotype Fish Conditions Figures
endocardium decreased anterior-posterior diameter, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
endocardium morphogenesis decreased process quality, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
endocardium aggregated, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
presumptive endocardium morphogenesis of an epithelial sheet decreased process quality, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
ventricular endocardium aggregated, abnormal WT + MO5-tal1 + MO6-tal1 standard conditions Fig. 3 with image from Schumacher et al., 2013
endocardium cell-cell junction mislocalised, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 5 with imageFig. 6 with image from Schumacher et al., 2013
endocardium endothelial cell obtuse, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 4 with imageFig. 5 with image from Schumacher et al., 2013
presumptive endocardium morphogenesis of an epithelial sheet decreased process quality, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 4 with image from Schumacher et al., 2013
endocardium endothelial cell aggregated, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 4 with image from Schumacher et al., 2013
endocardium cell-cell junction organization decreased process quality, abnormal zn1Tg + MO5-tal1 + MO6-tal1 standard conditions Fig. 5 with imageFig. 6 with image from Schumacher et al., 2013
ventricular endocardium aggregated, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB) standard conditions Fig. 1 with image from Schumacher et al., 2013
endocardium cardiac muscle cell differentiation process quality, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB) standard conditions Fig. 5 with imageFig. 7 with imageFig. 8 with image from Schumacher et al., 2013
endocardium morphogenesis decreased process quality, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB) standard conditions Fig. 1 with image from Schumacher et al., 2013
atrium lacks all parts of type ventricular endocardium, abnormal sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB) standard conditions Fig. 1 with image from Schumacher et al., 2013
Citations