Morpholino

MO5-tal1

ID

ZDB-MRPHLNO-051221-7

Name

MO5-tal1

Previous Names

scl ex 2 (1)

Target

tal1 (1)

Sequence

5' - AAAGCGGCGTTACCTGTTAATAGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-tal1

Expressed Gene	Anatomy	Figures
drl	(not) anterior lateral mesoderm posterior lateral mesoderm	Fig. 5, Fig. 6 from Juarez et al., 2005
gata1a	posterior lateral mesoderm	Fig. 6 from Juarez et al., 2005
ikzf1	(not) thymus	Fig. 4 from Juarez et al., 2005
lcp1	(not) macrophage	Fig. 5 from Juarez et al., 2005
lyz	(not) granulocyte	Fig. 5 from Juarez et al., 2005
myb	(not) ventral wall of dorsal aorta	Fig. 4 from Juarez et al., 2005
slc4a1a	(not) blood	Fig. 6 from Juarez et al., 2005
spi1b	(not) anterior lateral mesoderm posterior lateral mesoderm	Fig. 5 from Juarez et al., 2005
tal1	posterior lateral mesoderm	Fig. 2 from Juarez et al., 2005

Phenotype

Phenotype resulting from MO5-tal1

No data available

Phenotype of all Fish created by or utilizing MO5-tal1

Phenotype	Fish	Conditions	Figures
endocardium decreased anterior-posterior diameter, abnormal	WT + MO5-tal1 + MO6-tal1	standard conditions	Fig. 3 from Schumacher et al., 2013
endocardium morphogenesis decreased process quality, abnormal	WT + MO5-tal1 + MO6-tal1	standard conditions	Fig. 3 from Schumacher et al., 2013
endocardium aggregated, abnormal	WT + MO5-tal1 + MO6-tal1	standard conditions	Fig. 3 from Schumacher et al., 2013
presumptive endocardium morphogenesis of an epithelial sheet decreased process quality, abnormal	WT + MO5-tal1 + MO6-tal1	standard conditions	Fig. 3 from Schumacher et al., 2013
ventricular endocardium aggregated, abnormal	WT + MO5-tal1 + MO6-tal1	standard conditions	Fig. 3 from Schumacher et al., 2013
endocardium cell-cell junction mislocalised, abnormal	zn1Tg + MO5-tal1 + MO6-tal1	standard conditions	Fig. 5 , Fig. 6 from Schumacher et al., 2013
endocardium endothelial cell obtuse, abnormal	zn1Tg + MO5-tal1 + MO6-tal1	standard conditions	Fig. 4 , Fig. 5 from Schumacher et al., 2013
presumptive endocardium morphogenesis of an epithelial sheet decreased process quality, abnormal	zn1Tg + MO5-tal1 + MO6-tal1	standard conditions	Fig. 4 from Schumacher et al., 2013
endocardium endothelial cell aggregated, abnormal	zn1Tg + MO5-tal1 + MO6-tal1	standard conditions	Fig. 4 from Schumacher et al., 2013
endocardium cell-cell junction organization decreased process quality, abnormal	zn1Tg + MO5-tal1 + MO6-tal1	standard conditions	Fig. 5 , Fig. 6 from Schumacher et al., 2013
ventricular endocardium aggregated, abnormal	sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB)	standard conditions	Fig. 1 from Schumacher et al., 2013
endocardium cardiac muscle cell differentiation process quality, abnormal	sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB)	standard conditions	Fig. 5 , Fig. 7 , Fig. 8 from Schumacher et al., 2013
endocardium morphogenesis decreased process quality, abnormal	sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB)	standard conditions	Fig. 1 from Schumacher et al., 2013
atrium lacks all parts of type ventricular endocardium, abnormal	sd12Tg; y7Tg + MO5-tal1 + MO6-tal1 (AB)	standard conditions	Fig. 1 from Schumacher et al., 2013

Citations