Morpholino
MO5-tal1
- ID
- ZDB-MRPHLNO-051221-7
- Name
- MO5-tal1
- Previous Names
-
- scl ex 2 (1)
- Target
- Sequence
-
5' - AAAGCGGCGTTACCTGTTAATAGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-tal1
Expressed Gene | Anatomy | Figures |
---|---|---|
drl |
Fig. 5,
Fig. 6
from Juarez et al., 2005 |
|
gata1a |
Fig. 6
from Juarez et al., 2005 |
|
ikzf1 |
|
Fig. 4
from Juarez et al., 2005 |
lcp1 |
|
Fig. 5
from Juarez et al., 2005 |
lyz |
|
Fig. 5
from Juarez et al., 2005 |
1 - 5 of 9 Show all
Phenotype
Phenotype resulting from MO5-tal1
No data available
Phenotype of all Fish created by or utilizing MO5-tal1
1 - 5 of 14 Show all
Citations
- Liu, F., Bhang, S.H., Arentson, E., Sawada, A., Kim, C.K., Kang, I., Yu, J., Sakurai, N., Kim, S.H., Yoo, J.J., Kim, P., Pahng, S.H., Xia, Y., Solnica-Krezel, L., and Choi, K. (2013) Enhanced hemangioblast generation and improved vascular repair and regeneration from embryonic stem cells by defined transcription factors. Stem Cell Reports. 1(2):166-182
- Schumacher, J.A., Bloomekatz, J., Garavito-Aguilar, Z.V., and Yelon, D. (2013) tal1 regulates the formation of intercellular junctions and the maintenance of identity in the endocardium. Developmental Biology. 383(2):214-226
- Schoenebeck, J.J., Keegan, B.R., and Yelon, D. (2007) Vessel and blood specification override cardiac potential in anterior mesoderm. Developmental Cell. 13(2):254-267
- Juarez, M.A., Su, F., Chun, S., Kiel, M.J., and Lyons, S.E. (2005) Distinct roles for Scl in erythroid specification and maturation in zebrafish. The Journal of biological chemistry. 280(50):41636-41644
1 - 4 of 4
Show