Morpholino

MO1-vegfc

ID
ZDB-MRPHLNO-051212-2
Name
MO1-vegfc
Previous Names
  • vegfc ATG MO (1)
Target
Sequence
5' - GAAAATCCAAATAAGTGCATTTTAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vegfc
Phenotype
Phenotype resulting from MO1-vegfc
Phenotype of all Fish created by or utilizing MO1-vegfc
Phenotype Fish Conditions Figures
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-vegfc standard conditions Fig. 7 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-vegfc standard conditions Fig. 7 with image from Gore et al., 2011
lymphangiogenesis disrupted, abnormal WT + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4453Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO1-vegfc standard conditions Fig. 5 with image from Yan et al., 2017
lymphangiogenesis decreased occurrence, abnormal y1Tg + MO1-vegfc standard conditions Fig. 5 with image from Yan et al., 2017
blood vessel development disrupted, abnormal y1Tg + MO1-vegfc standard conditions Fig. 3 with image from Hogan et al., 2009
vascular lymphangioblast absent, abnormal y1Tg + MO1-vegfc standard conditions Fig. 6 with image from Yan et al., 2017
lymph vessel development disrupted, abnormal y1Tg + MO1-vegfc standard conditions Fig. 3 with image from Hogan et al., 2009
vascular lymphangioblast lymphangiogenesis decreased occurrence, abnormal y1Tg + MO1-vegfc standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct aplastic, abnormal y1Tg + MO1-vegfc standard conditions Fig. 3 with image from Hogan et al., 2009
primordial hindbrain channel aplastic, abnormal y1Tg + MO1-vegfc standard conditions Fig. 3 with image from Hogan et al., 2009
thoracic duct lymphangiogenesis decreased occurrence, abnormal y1Tg + MO1-vegfc standard conditions Fig. 6 with image from Yan et al., 2017
thoracic duct absent, abnormal y1Tg + MO1-vegfc standard conditions Fig. 6 with image from Yan et al., 2017
lymphangiogenesis disrupted, abnormal y1Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
angiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-vegfc + MO2-vegfc standard conditions Fig. 2 from Hogan et al., 2009
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-vegfc standard conditions Fig. 5 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-vegfc standard conditions Fig. 5 from Kim et al., 2014
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-vegfc + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-vegfc + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
artery aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymph vessel development process quality, abnormal s896Tg; y7Tg + MO1-apln + MO1-vegfc standard conditions Fig. 5 from Kim et al., 2014
lymph vessel endothelium endothelial cell decreased amount, abnormal s896Tg; y7Tg + MO1-apln + MO1-vegfc standard conditions Fig. 5 from Kim et al., 2014
trunk vasculature branchiness, abnormal sars1ko095/ko095; y1Tg + MO1-vegfc standard conditions Fig. 5 from Fukui et al., 2009
Citations