Morpholino
MO1-cntn2
- ID
- ZDB-MRPHLNO-051128-5
- Name
- MO1-cntn2
- Previous Names
-
- TAGMO1 (1)
- Target
- Sequence
-
5' - CCACACCCAGACCAGACACTTATTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cntn2
No data available
Phenotype
Phenotype resulting from MO1-cntn2
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-cntn2
1 - 5 of 23 Show all
Citations
- Gurung, S., Asante, E., Hummel, D., Williams, A., Feldman-Schultz, O., Halloran, M.C., Sittaramane, V., Chandrasekhar, A. (2018) Distinct roles for the cell adhesion molecule Contactin2 in the development and function of neural circuits in zebrafish. Mechanisms of Development. 152:1-12
- Stockinger, P., Maître, J.L., and Heisenberg, C.P. (2011) Defective neuroepithelial cell cohesion affects tangential branchiomotor neuron migration in the zebrafish neural tube. Development (Cambridge, England). 138(21):4673-4683
- Sittaramane, V., Sawant, A., Wolman, M.A., Maves, L., Halloran, M.C., and Chandrasekhar, A. (2009) The cell adhesion molecule Tag1, transmembrane protein Stbm/Vangl2, and Lamininalpha1 exhibit genetic interactions during migration of facial branchiomotor neurons in zebrafish. Developmental Biology. 325(2):363-373
- Wolman, M.A., Sittaramane, V., Essner, J.J., Yost, H.J., Chandrasekhar, A., and Halloran, M.C. (2008) Transient axonal glycoprotein-1 (TAG-1) and laminin-alpha1 regulate dynamic growth cone behaviors and initial axon direction in vivo. Neural Development. 3:6
- Liu, Y., and Halloran, M.C. (2005) Central and peripheral axon branches from one neuron are guided differentially by Semaphorin3D and transient axonal glycoprotein-1. The Journal of neuroscience : the official journal of the Society for Neuroscience. 25(45):10556-10563
1 - 5 of 5
Show