Morpholino

MO1-dnmt3bb.2

ID

ZDB-MRPHLNO-050809-5

Name

MO1-dnmt3bb.2

Previous Names

dnmt3-MO (1)

Target

dnmt3bb.2 (1)

Sequence

5' - CTCCGATCTTTACATCTGCCACCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dnmt3bb.2

Expressed Gene	Anatomy	Figures
ascl1a	brain (not) central nervous system	Fig. 1 , Fig. 4 , Fig. 5 from Rai et al., 2010
ascl1b	brain (not) central nervous system	Fig. 1 , Fig. 4 , Fig. 5 from Rai et al., 2010
atoh7	retinal ganglion cell	Fig. 3 from Rai et al., 2010
crx	(not) retina (not) retinal photoreceptor layer	Fig. 3 , Fig. 4 , Fig. 7 from Rai et al., 2010
fabp2	intestine	Fig. 2 from Rai et al., 2010
fabp10a	liver	Fig. 2 from Rai et al., 2010
gata6	pancreas	Fig. 2 , Fig. 7 from Rai et al., 2010
hand2	pharyngeal pouch (not) pharyngeal pouch 5 (not) pharyngeal pouch 6	Fig. 2 from Rai et al., 2010
ins	endocrine pancreas	Fig. 2 from Rai et al., 2010
lef1	whole organism	Fig. 5 from Rai et al., 2010
neurod1	(not) retina (not) retinal inner nuclear layer	Fig. 3 , Fig. 4 , Fig. 7 from Rai et al., 2010
neurog1	central nervous system	Fig. 1 from Rai et al., 2010
opn1sw1	(not) retina	Fig. 2 from Rai et al., 2010
opn1sw2	(not) retina	Fig. 2 from Rai et al., 2010
pax6b	eye	Fig. 3 from Rai et al., 2010
pcna	eye	Fig. 3 from Rai et al., 2010
prss1	pancreas	Fig. 2 , Fig. 7 from Rai et al., 2010
rbp3	(not) retinal pigmented epithelium	Fig. 2 , Fig. 4 from Rai et al., 2010

Phenotype

Phenotype resulting from MO1-dnmt3bb.2

Phenotype	Fish	Figures
brain decreased size, abnormal	WT + MO1-dnmt3bb.2	Fig. 1 from Rai et al., 2010
camera-type eye photoreceptor cell differentiation disrupted, abnormal	WT + MO1-dnmt3bb.2	Fig. 2 , Fig. 3 from Rai et al., 2010
DNA (cytosine-5-)-methyltransferase activity decreased occurrence, abnormal	WT + MO1-dnmt3bb.2	Fig. 5 from Rai et al., 2010
eye decreased size, abnormal	WT + MO1-dnmt3bb.2	Fig. 2 from Rai et al., 2010
head decreased size, abnormal	WT + MO1-dnmt3bb.2	Fig. 1 from Rai et al., 2010
histone H3K9 monomethyltransferase activity disrupted, abnormal	WT + MO1-dnmt3bb.2	Fig. 8 from Rai et al., 2010
lens morphology, abnormal	WT + MO1-dnmt3bb.2	Fig. 2 from Rai et al., 2010
pericardium edematous, abnormal	WT + MO1-dnmt3bb.2	Fig. 1 from Rai et al., 2010
retina disorganized, abnormal	WT + MO1-dnmt3bb.2	Fig. 2 from Rai et al., 2010
retina photopic photoreceptor cell absent, abnormal	WT + MO1-dnmt3bb.2	Fig. 3 from Rai et al., 2010
retina layer formation disrupted, abnormal	WT + MO1-dnmt3bb.2	Fig. 2 , Fig. 3 from Rai et al., 2010
retinal pigmented epithelium ventral region absent, abnormal	WT + MO1-dnmt3bb.2	Fig. 2 from Rai et al., 2010
whole organism dead, abnormal	WT + MO1-dnmt3bb.2	Fig. 1 from Rai et al., 2010

Phenotype of all Fish created by or utilizing MO1-dnmt3bb.2

Phenotype	Fish	Conditions	Figures
determination of heart left/right asymmetry disrupted, abnormal	AB/TU + MO1-dnmt3bb.2 + MO3-dnmt3bb.2	standard conditions	Figure 9 from Fillatre et al., 2019
heart tube mislocalised, abnormal	AB/TU + MO1-dnmt3bb.2 + MO3-dnmt3bb.2	standard conditions	Figure 9 from Fillatre et al., 2019
heart jogging process quality, abnormal	AB/TU + MO1-dnmt3bb.2 + MO3-dnmt3bb.2	standard conditions	Figure 9 from Fillatre et al., 2019
DNA (cytosine-5-)-methyltransferase activity decreased occurrence, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 5 from Rai et al., 2010
brain decreased size, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 1 from Rai et al., 2010
retinal pigmented epithelium ventral region absent, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 2 from Rai et al., 2010
head decreased size, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 1 from Rai et al., 2010
retina layer formation disrupted, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 2 , Fig. 3 from Rai et al., 2010
camera-type eye photoreceptor cell differentiation disrupted, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 2 , Fig. 3 from Rai et al., 2010
lens morphology, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 2 from Rai et al., 2010
histone H3K9 monomethyltransferase activity disrupted, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 8 from Rai et al., 2010
retina photopic photoreceptor cell absent, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 3 from Rai et al., 2010
pericardium edematous, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 1 from Rai et al., 2010
eye decreased size, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 2 from Rai et al., 2010
retina disorganized, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 2 from Rai et al., 2010
whole organism dead, abnormal	WT + MO1-dnmt3bb.2	standard conditions	Fig. 1 from Rai et al., 2010

Citations