header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050714-1
Morpholino Name: MO3-fgf8a
Target: fgf8a (1)
Previous Names: fgf8 MO (1), MO3-fgf8 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGTCTCATGTTTATAGCCTCAGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-fgf8a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-fgf8a
Expressed Gene Anatomy Figures
aldh1a2 Fig. 6 from Li et al., 2015
dlc Fig. 6 from Li et al., 2015
fgf4 Fig. 6 with image from Yamauchi et al., 2009
fgf16 Fig. 5 from Nomura et al., 2006
fgf22 Fig. 8 with image from Miyake et al., 2013
gata1a Fig. 8 with image from Warga et al., 2013
ins Fig. 3 from Song et al., 2007
meox1 Fig. 4 with image from Groves et al., 2005
myf5 Fig. 3 with image from Groves et al., 2005
mylpfa Fig. 2 with image from Groves et al., 2005
myod1 Fig. 3 with image from Groves et al., 2005
myog Fig. 3 with image from Groves et al., 2005
nkx2.5 Fig. 1 from Araki et al., 2001
pax2a Fig. 8 with image from Warga et al., 2013
Fig. 1 from Araki et al., 2001
pax3a Fig. 5 with image from Hammond et al., 2007
pax7a Fig. 5 with image from Hammond et al., 2007
sox32 Fig. 3 with image from Matsui et al., 2011
tbxta Fig. 8 with image from Warga et al., 2013
Fig. 3 with image from Matsui et al., 2011
PHENOTYPE
Phenotype resulting from MO3-fgf8a
Phenotype of all Fish created by or utilizing MO3-fgf8a
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased length, abnormal WT + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
brain apoptotic, abnormal WT + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
midbrain hindbrain boundary aplastic, abnormal WT + MO3-fgf8a standard conditions Fig. 1 from Araki et al., 2001
cerebellum absent, abnormal WT + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
cerebellum aplastic, abnormal WT + MO3-fgf8a standard conditions Fig. 1 from Araki et al., 2001
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
forerunner cell group distributed, abnormal WT + MO3-fgf8a standard conditions Fig. 3 with image from Matsui et al., 2011
retina morphology, abnormal pt6Tg + MO3-fgf8a standard conditions Fig. 3 with image from Molina et al., 2007
midbrain hindbrain boundary morphology, abnormal pt6Tg + MO3-fgf8a standard conditions Fig. 3 with image from Molina et al., 2007
otic vesicle morphology, abnormal pt6Tg + MO3-fgf8a standard conditions Fig. 3 with image from Molina et al., 2007
closure of optic fissure process quality, ameliorated AB + MO1-adamts16 + MO3-fgf8a standard conditions Fig. 5 with image from Cao et al., 2018
closure of optic fissure process quality, ameliorated AB + MO2-adamts16 + MO3-fgf8a standard conditions Fig. 5 with image from Cao et al., 2018
midbrain development disrupted, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 9 with image from Miyake et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-fgf24 + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-fgf24 + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
brain apoptotic, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
midbrain hindbrain boundary absent, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
pancreas mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
OTHER MO3-fgf8a MORPHOLINO PAGESNo links to external sites
CITATIONS (45)