Morpholino

MO1-cdx4

ID
ZDB-MRPHLNO-050509-7
Name
MO1-cdx4
Previous Names
  • cdx4 MO (1)
  • cdx4MO (1)
Target
Sequence
5' - CGTACATGATTTGGAAGAAACCCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdx4
Phenotype
Phenotype resulting from MO1-cdx4
Phenotype of all Fish created by or utilizing MO1-cdx4
Phenotype Fish Conditions Figures
post-vent region truncated, abnormal WT + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
post-vent region decreased length, abnormal WT + MO1-cdx4 standard conditions Fig. 2 from Ro et al., 2011
insulin secreting cell mislocalised anteriorly, abnormal WT + MO1-cdx4 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Kinkel et al., 2008
hindbrain increased length, abnormal WT + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
post-vent region kinked, abnormal WT + MO1-cdx4 standard conditions Fig. 2 from Ro et al., 2011
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
insulin secreting cell mislocalised posteriorly, abnormal WT + MO1-cdx4 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Kinkel et al., 2008
spinal cord decreased length, abnormal WT + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
post-vent region decreased size, abnormal WT + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
post-vent region has fewer parts of type somite, abnormal WT + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
regulation of endodermal cell fate specification disrupted, abnormal WT + MO1-cdx4 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Kinkel et al., 2008
hematopoietic cell decreased amount, abnormal sd2Tg + MO1-cdx4 control Fig. 3 with image from Qiu et al., 2016
blood cell decreased amount, abnormal sd2Tg + MO1-cdx4 control Fig. 3 with image from Qiu et al., 2016
blood island DsRed expression decreased amount, abnormal sd2Tg + MO1-cdx4 control Fig. 3 with image from Qiu et al., 2016
rhombomere 7 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
post-vent region truncated, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 6 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
post-vent region decreased size, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
presumptive blood absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. S4 with image from Skromne et al., 2007
rhombomere 7 decreased size, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
post-vent region aplastic, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with imageFig. 3 with image from Shimizu et al., 2006
Fig. Table 2 from Shimizu et al., 2005
spinal cord decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain increased length, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
post-vent region has fewer parts of type somite, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with imageFig. 2 with image from Skromne et al., 2007
spinal cord decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with imageFig. 2 with image from Skromne et al., 2007
spinal cord motor neuron absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
rhombomere increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 5 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
spinal cord oligodendrocyte absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
rhombomere 8 aplastic, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain increased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with imageFig. 2 with image from Skromne et al., 2007
rhombomere 4 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
whole organism decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with imageFig. 3 with image from Shimizu et al., 2006
hindbrain neuron mislocalised posteriorly, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 3 with image from Shimizu et al., 2006
rhombomere 6 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 5 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 4 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
Citations