Morpholino

MO1-cdx4

ID
ZDB-MRPHLNO-050509-7
Name
MO1-cdx4
Previous Names
  • cdx4 MO (1)
  • cdx4MO (1)
Target
Sequence
5' - CGTACATGATTTGGAAGAAACCCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdx4
Expressed Gene Anatomy Figures
aldh1a2 Fig. 5 with image,  Fig. S1 with image from Shimizu et al., 2006
cyp26a1 Fig. 5 with image,  Fig. S1 with image from Shimizu et al., 2006
drl Fig. 4 with image from Paik et al., 2013
egr2b Fig. 1 with image from Skromne et al., 2007
Fig. 2 with image,  Fig. 5 with image from Shimizu et al., 2006
fgf3 Fig. 5 with image from Shimizu et al., 2006
fgf8a Fig. 5 with image,  Fig. S1 with image from Shimizu et al., 2006
fli1 Fig. 4 with image from Paik et al., 2013
gata1a Fig. S5 from Ro et al., 2011
hbbe3 Fig. 2 from Davidson et al., 2003
hoxa9a Fig. 5 from Davidson et al., 2003
hoxb6b Fig. 5 from Davidson et al., 2003
hoxb7a Fig. 5 from Davidson et al., 2003
isl1a Fig. 1 with image from Skromne et al., 2007
myod1 Fig. 4 with image from Paik et al., 2013
olig2 Fig. 1 with image from Skromne et al., 2007
pax2a Fig. 4 with image from Paik et al., 2013
Fig. S5 from Ro et al., 2011
tbx16 Fig. 4 with image from Paik et al., 2013
Phenotype
Phenotype resulting from MO1-cdx4
Phenotype Fish Figures
blood cell decreased amount, abnormal sd2Tg + MO1-cdx4 Fig. 3 with image from Qiu et al., 2016
blood island DsRed expression decreased amount, abnormal sd2Tg + MO1-cdx4 Fig. 3 with image from Qiu et al., 2016
hematopoietic cell decreased amount, abnormal sd2Tg + MO1-cdx4 Fig. 3 with image from Qiu et al., 2016
hindbrain increased length, abnormal WT + MO1-cdx4 Fig. 1 with image from Skromne et al., 2007
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx4 Fig. 1 with image from Skromne et al., 2007
post-vent region decreased length, abnormal WT + MO1-cdx4 Fig. 2 from Ro et al., 2011
post-vent region decreased size, abnormal WT + MO1-cdx4 Fig. Table 2 from Shimizu et al., 2005
post-vent region has fewer parts of type somite, abnormal WT + MO1-cdx4 Fig. Table 2 from Shimizu et al., 2005
post-vent region kinked, abnormal WT + MO1-cdx4 Fig. 2 from Ro et al., 2011
post-vent region truncated, abnormal WT + MO1-cdx4 Fig. Table 2 from Shimizu et al., 2005
spinal cord decreased length, abnormal WT + MO1-cdx4 Fig. 1 with image from Skromne et al., 2007
Phenotype of all Fish created by or utilizing MO1-cdx4
Phenotype Fish Conditions Figures
post-vent region truncated, abnormal WT + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
post-vent region decreased length, abnormal WT + MO1-cdx4 standard conditions Fig. 2 from Ro et al., 2011
insulin secreting cell mislocalised anteriorly, abnormal WT + MO1-cdx4 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Kinkel et al., 2008
hindbrain increased length, abnormal WT + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
post-vent region kinked, abnormal WT + MO1-cdx4 standard conditions Fig. 2 from Ro et al., 2011
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
insulin secreting cell mislocalised posteriorly, abnormal WT + MO1-cdx4 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Kinkel et al., 2008
spinal cord decreased length, abnormal WT + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
post-vent region decreased size, abnormal WT + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
post-vent region has fewer parts of type somite, abnormal WT + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
regulation of endodermal cell fate specification disrupted, abnormal WT + MO1-cdx4 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Kinkel et al., 2008
hematopoietic cell decreased amount, abnormal sd2Tg + MO1-cdx4 control Fig. 3 with image from Qiu et al., 2016
blood cell decreased amount, abnormal sd2Tg + MO1-cdx4 control Fig. 3 with image from Qiu et al., 2016
blood island DsRed expression decreased amount, abnormal sd2Tg + MO1-cdx4 control Fig. 3 with image from Qiu et al., 2016
rhombomere 7 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
post-vent region truncated, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 6 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
post-vent region decreased size, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
presumptive blood absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. S4 with image from Skromne et al., 2007
rhombomere 7 decreased size, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
post-vent region aplastic, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 3 with image from Shimizu et al., 2006
Fig. Table 2 from Shimizu et al., 2005
spinal cord decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain increased length, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
post-vent region has fewer parts of type somite, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 2 with image from Skromne et al., 2007
spinal cord decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 2 with image from Skromne et al., 2007
spinal cord motor neuron absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
rhombomere increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
spinal cord oligodendrocyte absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
rhombomere 5 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
rhombomere 8 aplastic, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 4 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain increased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 2 with image from Skromne et al., 2007
whole organism decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 3 with image from Shimizu et al., 2006
hindbrain neuron mislocalised posteriorly, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 3 with image from Shimizu et al., 2006
rhombomere 6 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 5 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 4 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.