header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050208-10
Morpholino Name: MO1-gata1a
Target: gata1a (1)
Previous Names: gata1 MO (1), MO(T)-gata1 (1), MO1-gata1, Gata1 morpholino (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGCAAGTGTAGTATTGAAGATGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: A translation blocking morpholino targeting gata1.
This morpholino sequence was reported with an additional nucleotide in Rhodes et al. 2005 and is correct as displayed here confirmed by author.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gata1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gata1a
Expressed Gene Anatomy Figures
alas2 Fig. 3 with image from Galloway et al., 2005
blvra Fig. 6 from Holowiecki et al., 2017
blvrb Fig. 6 from Holowiecki et al., 2017
bmp4 Fig. 2 with image from Vermot et al., 2009
cahz Fig. 2 from Galloway et al., 2008
Fig. 3 with image from Galloway et al., 2005
edn1 Fig. 2 with image from Vermot et al., 2009
foxc1a Fig. 6 with image from Chen et al., 2017
foxc1b Fig. 6 with image from Chen et al., 2017
gata1a Fig. 2 from Galloway et al., 2008
Fig. 3 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
glcci1a Fig. 4 with image from Galloway et al., 2005
hbae1.1 Fig. 4 from Rhodes et al., 2005
hbae3 Fig. 5 with image from Glenn et al., 2014
hbbe1.1 Fig. 1 with imageFig. 2 with imageFig. 3 with image from Galloway et al., 2005
hbbe3 Fig. 2 from Galloway et al., 2008
her9 Fig. 4 with image from Chen et al., 2017
hey1 Fig. 4 with image from Chen et al., 2017
hey2 Fig. 4 with image from Chen et al., 2017
ikzf1 Fig. 2 from Galloway et al., 2008
Fig. 1 with image from Galloway et al., 2005
irf8 Fig. S1 with image from Glenn et al., 2014
jag1b Fig. 4 with image from Chen et al., 2017
klf2a Fig. 2 with image from Vermot et al., 2009
klf17 Fig. 4 with image from Galloway et al., 2005
krcp Fig. 4 with image from Galloway et al., 2005
lcp1 Fig. 6 from Clatworthy et al., 2009
Fig. 7 with image from Yeh et al., 2008
Fig. 1 with imageFig. S1 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
lmo2 Fig. 5 from Rhodes et al., 2005
lyz Fig. S1 with image from Glenn et al., 2014
mir21-1 Fig. 3 from Banjo et al., 2013
mpx Fig. 5 with imageFig. 6 with imageFig. S2 with image from Glenn et al., 2014
Fig. 7 with image from Yeh et al., 2008
Fig. 1 with imageFig. S1 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
myb Fig. 1 with image from Galloway et al., 2005
notch1b Fig. 4 with image from Chen et al., 2017
Fig. 2 with image from Vermot et al., 2009
nrg1 Fig. 2 with image from Vermot et al., 2009
runx1 Fig. 1 with image from Galloway et al., 2005
Fig. 5 from Rhodes et al., 2005
smchd1 Fig. 4 with image from Galloway et al., 2005
spi1b Fig. 2 with imageFig. 4 with image from Takeuchi et al., 2015
Fig. 6 with image from Glenn et al., 2014
Fig. 3 from Sumanas et al., 2008
Fig. 7 with image from Yeh et al., 2008
Fig. 1 with imageFig. 2 with image from Galloway et al., 2005
Fig. 4 from Rhodes et al., 2005
tal1 Fig. 5 from Rhodes et al., 2005
vegfc Fig. 8 with image from Helker et al., 2013
znfl2a Fig. S3 from Galloway et al., 2008
PHENOTYPE
Phenotype resulting from MO1-gata1a
Phenotype Figures
atrial endocardium endothelial cell increased amount, abnormal Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling increased amount, abnormal Fig. 5 with image from Steed et al., 2016
atrioventricular canal blood circulation process quality, abnormal Fig. 2 with image from Heckel et al., 2015
atrioventricular valve morphology, abnormal Fig. 2 with image from Vermot et al., 2009
blood decreased viscosity, abnormal Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal Fig. 2 with image from Vermot et al., 2009
blood island spi1b expression mislocalised, abnormal Fig. 2 with image from Takeuchi et al., 2015
cardiac ventricle EGFP expression increased amount, abnormal Fig. 2 with image from Heckel et al., 2015
caudal hematopoietic tissue blvrb expression increased amount, abnormal Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvra expression increased amount, abnormal Fig. 6 from Holowiecki et al., 2017
common cardinal vein blood vessel endothelial cell decreased amount, abnormal Fig. 8 with image from Helker et al., 2013
dorsal aorta foxc1b expression decreased amount, abnormal Fig. 6 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal Fig. 2 with image from Chen et al., 2017
endothelial cell notch1b expression decreased amount, abnormal Fig. 4 with image from Chen et al., 2017
endothelial cell hey2 expression decreased amount, abnormal Fig. 4 with image from Chen et al., 2017
endothelial cell hey1 expression decreased amount, abnormal Fig. 4 with image from Chen et al., 2017
endothelial cell jag1b expression decreased amount, abnormal Fig. 4 with image from Chen et al., 2017
endothelial cell her9 expression decreased amount, abnormal Fig. 4 with image from Chen et al., 2017
heart blvrb expression increased amount, abnormal Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvrb expression absent, abnormal Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvra expression decreased amount, abnormal Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal Fig. 4 with image from Takeuchi et al., 2015
liver blvrb expression increased amount, abnormal Fig. 6 from Holowiecki et al., 2017
myeloid cell increased amount, abnormal Fig. S6 with image from Hall et al., 2007
nucleate erythrocyte absent, abnormal Fig. 2 with image from Chen et al., 2017
Fig. 8 with image from Helker et al., 2013
nucleate erythrocyte development disrupted, abnormal Fig. 8 with image from Helker et al., 2013
whole organism foxc1b expression decreased amount, abnormal Fig. 6 with image from Chen et al., 2017
whole organism foxc1a expression decreased amount, abnormal Fig. 6 with image from Chen et al., 2017

Phenotype of all Fish created by or utilizing MO1-gata1a
Phenotype Fish Conditions Figures
blood island spi1b expression mislocalised, abnormal AB/TL + MO1-gata1a standard conditions Fig. 2 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB/TL + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
liver blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvra expression decreased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvrb expression absent, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
heart blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvra expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
blood circulating cell absent, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve morphology, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
blood decreased viscosity, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
whole organism foxc1b expression decreased amount, abnormal WT + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
nucleate erythrocyte development disrupted, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
nucleate erythrocyte absent, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
whole organism foxc1a expression decreased amount, abnormal WT + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
myeloid cell increased amount, abnormal WT + MO1-gata1a standard conditions Fig. S6 with image from Hall et al., 2007
dorsal aorta foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
whole organism foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
cardiac ventricle EGFP expression increased amount, abnormal ig11Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
endothelial cell jag1b expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell hey1 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell notch1b expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell hey2 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell her9 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling increased amount, abnormal ubs10Tg + MO1-gata1a control Fig. 5 with image from Steed et al., 2016
atrial endocardium endothelial cell increased amount, abnormal ubs10Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
dorsal aorta foxc1b expression amount, ameliorated hu10049Tg; kca3Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
whole organism foxc1b expression amount, ameliorated hu10049Tg; kca3Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg ; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg ; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg ; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
nucleate erythrocyte absent, abnormal s843Tg ; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-gata1a(AB/TL) standard conditions Fig. 4 with image from Takeuchi et al., 2015
blood island spi1b expression position, ameliorated kdm1ait627/it627 + MO1-gata1a(AB/TL) standard conditions Fig. 2 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB/TL + MO1-etv2 + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
atrioventricular valve morphology, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
blood decreased viscosity, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-etv2 + MO1-gata1a(AB/TL) standard conditions Fig. 4 with image from Takeuchi et al., 2015
atrioventricular canal EGFP expression decreased amount, abnormal ig11Tg + MO1-gata1a + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
OTHER MO1-gata1a MORPHOLINO PAGESNo links to external sites
CITATIONS (36)