Morpholino

MO1-gata1a

ID
ZDB-MRPHLNO-050208-10
Name
MO1-gata1a
Previous Names
  • gata1 MO (1)
  • MO(T)-gata1 (1)
  • MO1-gata1
  • Gata1 morpholino (1)
Target
Sequence
5' - CTGCAAGTGTAGTATTGAAGATGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino targeting gata1.
This morpholino sequence was reported with an additional nucleotide in Rhodes et al. 2005 and is correct as displayed here confirmed by author.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata1a
No data available
Phenotype
Phenotype resulting from MO1-gata1a
Phenotype Fish Figures
atrial endocardium endothelial cell increased amount, abnormal ubs10Tg + MO1-gata1a Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling increased amount, abnormal ubs10Tg + MO1-gata1a Fig. 5 with image from Steed et al., 2016
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata1a Fig. 2 with image from Heckel et al., 2015
atrioventricular valve morphology, abnormal WT + MO1-gata1a Fig. 2 with image from Vermot et al., 2009
blood decreased viscosity, abnormal WT + MO1-gata1a Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal WT + MO1-gata1a Fig. 2 with image from Vermot et al., 2009
blood island spi1b expression mislocalised, abnormal AB + MO1-gata1a Fig. 2 with image from Takeuchi et al., 2015
cardiac ventricle EGFP expression increased amount, abnormal ig11Tg + MO1-gata1a Fig. 2 with image from Heckel et al., 2015
caudal hematopoietic tissue blvra expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-gata1a Fig. 8 with image from Helker et al., 2013
dorsal aorta foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a Fig. 6 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
endothelial cell notch1b expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell hey2 expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell hey1 expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell jag1b expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
endothelial cell elnb expression decreased amount, abnormal s843Tg/s843Tg + MO1-gata1a Fig. 5 from Facchinello et al., 2022
endothelial cell elna expression decreased amount, abnormal s843Tg/s843Tg + MO1-gata1a Fig. 5 from Facchinello et al., 2022
endothelial cell her9 expression decreased amount, abnormal s843Tg + MO1-gata1a Fig. 4 with image from Chen et al., 2017
erythroid lineage cell slc4a1a expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
heart blvrb expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
hematopoietic system drl expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.3 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.1 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.2 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm blvrb expression absent, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm drl expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.3 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm blvra expression decreased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm drll.2 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.1 expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm spi1b expression increased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-gata1a Fig. 4 with image from Takeuchi et al., 2015
liver blvrb expression increased amount, abnormal TL + MO1-gata1a Fig. 6 from Holowiecki et al., 2017
monocyte lcp1 expression increased amount, abnormal AB + MO1-gata1a Fig. 6 with image from Pimtong et al., 2014
myeloid cell increased amount, abnormal WT + MO1-gata1a Fig. S6 with image from Hall et al., 2007
nucleate erythrocyte absent, abnormal s843Tg; uto5Tg + MO1-gata1a Fig. 2 with image from Chen et al., 2017
Fig. 8 with image from Helker et al., 2013
nucleate erythrocyte hbae1.1 expression increased distribution, abnormal TU + MO1-gata1a Fig. 5 from Li et al., 2020
nucleate erythrocyte development disrupted, abnormal WT + MO1-gata1a Fig. 8 with image from Helker et al., 2013
whole organism foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a Fig. 6 with image from Chen et al., 2017
whole organism foxc1a expression decreased amount, abnormal WT + MO1-gata1a Fig. 6 with image from Chen et al., 2017
Phenotype of all Fish created by or utilizing MO1-gata1a
Phenotype Fish Conditions Figures
endothelial cell elnb expression decreased amount, abnormal s843Tg/s843Tg + MO1-gata1a standard conditions Fig. 5 from Facchinello et al., 2022
endothelial cell elna expression decreased amount, abnormal s843Tg/s843Tg + MO1-gata1a standard conditions Fig. 5 from Facchinello et al., 2022
intermediate cell mass of mesoderm drll.3 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drl expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
erythroid lineage cell slc4a1a expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.3 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm drll.2 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
blood island spi1b expression mislocalised, abnormal AB + MO1-gata1a standard conditions Fig. 2 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm drll.1 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.2 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression increased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drl expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
hematopoietic system drll.1 expression decreased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
monocyte lcp1 expression increased amount, abnormal AB + MO1-gata1a standard conditions Fig. 6 with image from Pimtong et al., 2014
caudal hematopoietic tissue blvra expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
liver blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvra expression decreased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
intermediate cell mass of mesoderm blvrb expression absent, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
heart blvrb expression increased amount, abnormal TL + MO1-gata1a standard conditions Fig. 6 from Holowiecki et al., 2017
nucleate erythrocyte hbae1.1 expression increased distribution, abnormal TU + MO1-gata1a control Fig. 5 from Li et al., 2020
blood circulating cell absent, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve morphology, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
whole organism foxc1b expression decreased amount, abnormal WT + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
nucleate erythrocyte development disrupted, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
nucleate erythrocyte absent, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
common cardinal vein blood vessel endothelial cell decreased amount, abnormal WT + MO1-gata1a standard conditions Fig. 8 with image from Helker et al., 2013
myeloid cell increased amount, abnormal WT + MO1-gata1a standard conditions Fig. S6 with image from Hall et al., 2007
blood decreased viscosity, abnormal WT + MO1-gata1a standard conditions Fig. 2 with image from Vermot et al., 2009
whole organism foxc1a expression decreased amount, abnormal WT + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
dorsal aorta foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
whole organism foxc1b expression decreased amount, abnormal hu10049Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
cardiac ventricle EGFP expression increased amount, abnormal ig11Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
endothelial cell jag1b expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell hey1 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell hey2 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell notch1b expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
endothelial cell her9 expression decreased amount, abnormal s843Tg + MO1-gata1a control Fig. 4 with image from Chen et al., 2017
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling increased amount, abnormal ubs10Tg + MO1-gata1a control Fig. 5 with image from Steed et al., 2016
atrial endocardium endothelial cell increased amount, abnormal ubs10Tg + MO1-gata1a control Fig. 2 with image from Heckel et al., 2015
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
nucleate erythrocyte absent, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-gata1a control Fig. 2 with image from Chen et al., 2017
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-gata1a (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
blood island spi1b expression position, ameliorated kdm1ait627/it627 + MO1-gata1a (AB) standard conditions Fig. 2 with image from Takeuchi et al., 2015
nucleate erythrocyte hbae1.1 expression spatial pattern, ameliorated p2ry12sih3/sih3 + MO1-gata1a (TU) control Fig. 5 from Li et al., 2020
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-etsrp + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
blood decreased viscosity, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve morphology, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-etsrp + MO1-gata1a (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
atrioventricular canal EGFP expression decreased amount, abnormal ig11Tg + MO1-gata1a + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-gata1a standard conditions Figure 4 with image from Li et al., 2021
dorsal aorta foxc1b expression amount, ameliorated hu10049Tg; kca3Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
whole organism foxc1b expression amount, ameliorated hu10049Tg; kca3Tg + MO1-gata1a control Fig. 6 with image from Chen et al., 2017
Citations