Morpholino
MO1-olig2
- ID
- ZDB-MRPHLNO-050204-2
- Name
- MO1-olig2
- Previous Names
-
- MO(T)-olig2
- olig2-MO (1)
- Target
- Sequence
-
5' - CGTTCAGTGCGCTCTCAGCTTCTCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino against olig2
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-olig2
Expressed Gene | Anatomy | Figures |
---|---|---|
irx3a |
Fig. 4 ![]() |
|
isl2a |
Fig. 5 ![]() |
|
mbpa |
|
Fig. 8 ![]() |
plp1a |
Fig. 6 ![]() |
|
plp1b |
Fig. 8 ![]() |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO1-olig2
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-olig2
1 - 5 of 9 Show all
Citations
- Tsai, T.Y., Sikora, M., Xia, P., Colak-Champollion, T., Knaut, H., Heisenberg, C.P., Megason, S.G. (2020) An adhesion code ensures robust pattern formation during tissue morphogenesis. Science (New York, N.Y.). 370:113-116
- Lim, A.H., Suli, A., Yaniv, K., Weinstein, B., Li, D.Y., and Chien, C.B. (2011) Motoneurons are essential for vascular pathfinding. Development (Cambridge, England). 138(17):3847-3857
- Borodovsky, N., Ponomaryov, T., Frenkel, S., and Levkowitz, G. (2009) Neural protein Olig2 acts upstream of the transcriptional regulator sim1 to specify diencephalic dopaminergic neurons. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(4):826-834
- Schebesta, M., and Serluca, F.C. (2009) olig1 expression identifies developing oligodendrocytes in zebrafish and requires hedgehog and notch signaling. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(4):887-898
- Bae, Y.K., Shimizu, T., and Hibi, M. (2005) Patterning of proneuronal and inter-proneuronal domains by hairy- and enhancer of split-related genes in zebrafish neuroectoderm. Development (Cambridge, England). 132(6):1375-1385
- Lewis, K.E., Bates, J., and Eisen, J.S. (2005) Regulation of iro3 expression in the zebrafish spinal cord. Developmental Dynamics : an official publication of the American Association of Anatomists. 232(1):140-148
- Park, H.-C., Mehta, A., Richardson, J.S., and Appel, B. (2002) olig2 is required for zebrafish primary motor neuron and oligodendrocyte development. Developmental Biology. 248(2):356-368
1 - 7 of 7
Show