FIGURE

Fig. S5

ID
ZDB-FIG-110111-43
Publication
Bresciani et al., 2010 - Zebrafish numb and numblike are involved in primitive erythrocyte differentiation
Other Figures
All Figure Page
Back to All Figure Page
Fig. S5

Single numb and numblike knockdown reproduce the nb/nbl morphants hematopoietic defects with low penetrance. A?B. Injection of nb MO1 and nbl MO1 specifically blocks splicing of the targeted pre-mRNAs. PCR reactions were performed on cDNAs retrotranscribed from total RNA extracted from 29 hpf nb MO1 injected embryos (1.4 pmol/embryo; A), nbl MO1 injected embryos (0.3 pmol/embryo; B), std MO injected embryos (0.3 pmol/embryo or 1.4 pmol/embryo; A, B). β-actin has been tested as an internal control (data not shown). A control PCR reaction performed without cDNA is shown in lane 3 of both the boxes (A, B). Primers: nb MO1-5′: CACCAGTGGCAGACCGATGAA nb MO1-3′: ACCGCTCGCACAGCCTTCTTA nbl MO1-5′: TCGGGCTGGTGGAGGTGGAT nbl MO1-3′: CCGTCACGGCAGATGTAAGAG. C. Single injection of nb MO1 (1.4 pmol/embryo) or nbl MO1 (0.3 pmol/embryo) in Tg(gata1:dsRed) produces the hematopoietic phenotype respectively in ∼19% (n = 99) and ∼25% (n = 125) of the MO injected embryos (*p<0.05 vs std MO no defects, **p<0.01 vs std MO no defects, #p<0.05 vs std MO defects, ##p<0.01 vs std MO defects). 100% of control embryos was unaffected (n = 65).

Expression Data

Expression Detail
Antibody Labeling
Phenotype Data
Fish:
Knockdown Reagents:
Observed In:
Stage: Long-pec

Phenotype Detail
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ PLoS One