CRISPR

CRISPR6-fbn3

ID

ZDB-CRISPR-260616-2

Name

CRISPR6-fbn3

Previous Names

None

Target

fbn3 (1)

Sequence

5' - TGCGAGAGCGGATGTCAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cmg96	fbn3
cmg97	fbn3

Expression

Gene expression in Wild Types + CRISPR6-fbn3

No data available

Phenotype

Phenotype resulting from CRISPR6-fbn3

No data available

Phenotype of all Fish created by or utilizing CRISPR6-fbn3

Phenotype	Fish	Conditions	Figures
dorsal aorta neutrophil increased amount, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 6 from De Rycke et al., 2026
ventriculo bulbo valve malformed, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 8 from De Rycke et al., 2026
cardiac ventricle dilated, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 7 from De Rycke et al., 2026
atrial endocardium detached from atrium, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 3 from De Rycke et al., 2026
ventriculo bulbo valve increased thickness, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 8 from De Rycke et al., 2026
whole organism fbn3 expression decreased amount, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 3 from De Rycke et al., 2026
heart contraction irregular rhythm, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 7 from De Rycke et al., 2026
caudal vein dilated, exacerbated	fbn3^cmg96/cmg96 (AB)	chemical treatment by environment: diacetylmonoxime	Figure 4 from De Rycke et al., 2026
heart blood circulation increased magnitude, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 7 from De Rycke et al., 2026
bulbus arteriosus dilated, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 7 from De Rycke et al., 2026
pericardium edematous, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 3 from De Rycke et al., 2026
caudal vein neutrophil increased amount, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 6 from De Rycke et al., 2026
caudal vein malformed, abnormal	fbn3^cmg96/cmg96 (AB)	control	Figure 4 from De Rycke et al., 2026
heart contraction increased frequency, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 3 from De Rycke et al., 2026
ventral fin fold atrophied, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 3 from De Rycke et al., 2026
caudal vein permeable, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 4 from De Rycke et al., 2026
bulbus arteriosus increased diameter, abnormal	fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 3 from De Rycke et al., 2026
bulbus arteriosus increased diameter, abnormal	fbn1^cmg80/cmg80; fbn2^cmg86/cmg86; fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 5 from De Rycke et al., 2026
whole organism decreased length, abnormal	fbn1^cmg80/cmg80; fbn2^cmg86/cmg86; fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 5 from De Rycke et al., 2026
atrial endocardium detached from atrium, abnormal	fbn1^cmg80/cmg80; fbn2^cmg86/cmg86; fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 5 from De Rycke et al., 2026
ventral fin fold atrophied, abnormal	fbn1^cmg80/cmg80; fbn2^cmg86/cmg86; fbn3^cmg96/cmg96 (AB)	standard conditions	Figure 5 from De Rycke et al., 2026

Citations