CRISPR

CRISPR7-arhgef7b

ID

ZDB-CRISPR-260507-17

Name

CRISPR7-arhgef7b

Previous Names

None

Target

arhgef7b (1)

Sequence

5' - GGAGTGTGAAGCCATTTCAGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
pku403Gt	arhgef7b

Expression

Gene expression in Wild Types + CRISPR7-arhgef7b

No data available

Phenotype

Phenotype resulting from CRISPR7-arhgef7b

No data available

Phenotype of all Fish created by or utilizing CRISPR7-arhgef7b

Phenotype	Fish	Conditions	Figures
glial cell arhgef7b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 4 from Chiu et al., 2026
hindbrain neuron pax2a expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 2 from Chiu et al., 2026
hindbrain neuronal stem cell nes expression increased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 2 from Chiu et al., 2026
whole organism arhgef7b expression increased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 1 from Chiu et al., 2026
glial cell stmn1b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 4 from Chiu et al., 2026
hindbrain glioblast nes expression increased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 2 from Chiu et al., 2026
glial cell stmn4l expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 4 from Chiu et al., 2026
brain hemorrhagic, ameliorated	arhgef7b^{pku403Gt/pku403Gt}	chemical treatment by environment: IPA-3	Fig. 2 from Chiu et al., 2026
glial cell stmn1a expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 4 from Chiu et al., 2026
neuronal stem cell neuron differentiation increased occurrence, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 4 from Chiu et al., 2026
brain hemorrhagic, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 1 , Fig. 2 from Chiu et al., 2026
glial cell ppfia3 expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}	standard conditions	Fig. 4 from Chiu et al., 2026
head angiogenesis decreased occurrence, abnormal	WT + CRISPR2-arhgef7b + CRISPR4-arhgef7b + CRISPR5-arhgef7b + CRISPR6-arhgef7b + CRISPR7-arhgef7b	standard conditions	Fig. 6 from Chiu et al., 2026
head endothelial cell rpl39 expression decreased amount, abnormal	WT + CRISPR2-arhgef7b + CRISPR4-arhgef7b + CRISPR5-arhgef7b + CRISPR6-arhgef7b + CRISPR7-arhgef7b	standard conditions	Fig. 6 from Chiu et al., 2026
head endothelial cell cdh5 expression increased amount, abnormal	WT + CRISPR2-arhgef7b + CRISPR4-arhgef7b + CRISPR5-arhgef7b + CRISPR6-arhgef7b + CRISPR7-arhgef7b	standard conditions	Fig. 6 from Chiu et al., 2026
head endothelial cell tp53 expression increased amount, abnormal	WT + CRISPR2-arhgef7b + CRISPR4-arhgef7b + CRISPR5-arhgef7b + CRISPR6-arhgef7b + CRISPR7-arhgef7b	standard conditions	Fig. 6 from Chiu et al., 2026
head endothelial cell rps29 expression decreased amount, abnormal	WT + CRISPR2-arhgef7b + CRISPR4-arhgef7b + CRISPR5-arhgef7b + CRISPR6-arhgef7b + CRISPR7-arhgef7b	standard conditions	Fig. 6 from Chiu et al., 2026
hindbrain glial cell abnormal, abnormal	arhgef7b^{pku403Gt/pku403Gt}; mi2001Tg/mi2001Tg	standard conditions	Fig. 2 from Chiu et al., 2026
hindbrain glial cell shortened, abnormal	arhgef7b^{pku403Gt/pku403Gt}; mi2001Tg/mi2001Tg	standard conditions	Fig. 2 from Chiu et al., 2026
hindbrain glioblast stmn1a expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
glial cell ppfia3 expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
hindbrain neuronal stem cell stmn1a expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
whole organism stmn1a expression amount, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	chemical treatment by environment: IPA-3	Fig. 5 from Chiu et al., 2026
head glial cell stmn1b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 5 from Chiu et al., 2026
glial cell arhgef7b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
hindbrain glioblast stmn1b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
glial cell stmn4l expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
brain hemorrhagic, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	chemical treatment by environment: IPA-3	Fig. 3 from Chiu et al., 2026
hindbrain glioblast stmn4l expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
whole organism stmn4l expression amount, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	chemical treatment by environment: IPA-3	Fig. 5 from Chiu et al., 2026
glial cell stmn1a expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
head glial cell stmn4l expression amount, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	chemical treatment by environment: IPA-3	Fig. 5 from Chiu et al., 2026
glial cell stmn1b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
brain hemorrhagic, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 3 from Chiu et al., 2026
head glial cell stmn1a expression amount, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	chemical treatment by environment: IPA-3	Fig. 5 from Chiu et al., 2026
hindbrain neuronal stem cell stmn1b expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
head glial cell stmn4l expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 5 from Chiu et al., 2026
hindbrain neuronal stem cell stmn4l expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 4 from Chiu et al., 2026
head glial cell stmn1b expression amount, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	chemical treatment by environment: IPA-3	Fig. 5 from Chiu et al., 2026
head glial cell stmn1a expression decreased amount, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg	standard conditions	Fig. 5 from Chiu et al., 2026
hindbrain blood vessel mCherry expression spatial pattern, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg; zf2119Tg/zf2119Tg	chemical treatment by environment: IPA-3	Fig. 3 from Chiu et al., 2026
brain hemorrhagic, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg; zf2119Tg/zf2119Tg	chemical treatment by environment: IPA-3	Fig. 3 from Chiu et al., 2026
hindbrain blood vessel mCherry expression spatial pattern, ameliorated	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg; zf2119Tg/zf2119Tg	standard conditions	Fig. 3 from Chiu et al., 2026
brain hemorrhagic, abnormal	arhgef7b^{pku403Gt/pku403Gt}; pku424Tg/pku424Tg; zf2119Tg/zf2119Tg	standard conditions	Fig. 3 from Chiu et al., 2026

Citations