CRISPR

CRISPR4-ace2

ID
ZDB-CRISPR-251010-2
Name
CRISPR4-ace2
Previous Names
None
Target
Sequence
5' - GGCCTGCTGTCAGACTGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
syu701 ace2
Expression
Gene expression in Wild Types + CRISPR4-ace2
No data available
Phenotype
Phenotype resulting from CRISPR4-ace2
No data available
Phenotype of all Fish created by or utilizing CRISPR4-ace2
Phenotype Fish Conditions Figures
liver igf2r expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
liver igf1rb expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
muscle L-serine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-glutamine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle area density, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-arginine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-tryptophan decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle hydroxyproline increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
liver hk1 expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
intestine host-mediated modulation of intestinal microbiota composition decreased process quality, abnormal ace2syu701/syu701 standard conditions Fig. 3 with image from Wu et al., 2025
muscle L-cysteine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
liver ugp2a expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
muscle L-alanine increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-tyrosine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
whole organism decreased length, abnormal ace2syu701/syu701 standard conditions Fig. 1 with image from Wu et al., 2025
liver hk2 expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
muscle L-methionine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle valine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle amino acid decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-lysine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-leucine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
hypophysis gh1 expression decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 1 with image from Wu et al., 2025
blood plasma amino acid decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-proline decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
whole organism decreased weight, abnormal ace2syu701/syu701 standard conditions Fig. 1 with image from Wu et al., 2025
muscle L-glutamic acid decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
liver pklr expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
muscle L-aspartic acid decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
muscle L-isoleucine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
liver igf1ra expression increased amount, abnormal ace2syu701/syu701 standard conditions Fig. 5 with image from Wu et al., 2025
muscle L-phenylalanine decreased amount, abnormal ace2syu701/syu701 standard conditions Fig. 2 with image from Wu et al., 2025
Citations