CRISPR

CRISPR2-cox7a1

ID
ZDB-CRISPR-240320-15
Name
CRISPR2-cox7a1
Previous Names
  • cox7a1 sgRNA2 (1)
Target
Sequence
5' - AGGAAAATTTTCTGTTTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
brn6 cox7a1
Expression
Gene expression in Wild Types + CRISPR2-cox7a1
No data available
Phenotype
Phenotype resulting from CRISPR2-cox7a1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-cox7a1
Phenotype Fish Conditions Figures
skeletal muscle formate increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart glycerophosphocholine increased amount, abnormal cox7a1brn6/brn6 amputation: cardiac ventricle Fig. 6 with image from García-Poyatos et al., 2024
regenerating tissue proliferative region increased amount, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
heart formate increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
heart alanine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
whole organism mitochondrion Ab1-uqcrc2 labeling decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 1 with image from García-Poyatos et al., 2024
skeletal muscle adenosine 5'-monophosphate decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle calcium cation increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 2 with image from García-Poyatos et al., 2024
swimming behavior decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
heart alanine increased amount, abnormal cox7a1brn6/brn6 amputation: cardiac ventricle Fig. 6 with image from García-Poyatos et al., 2024
whole organism regulation of oxidative phosphorylation decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 1 with image from García-Poyatos et al., 2024
heart striated muscle cell differentiation decreased process quality, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
skeletal muscle regulation of oxidative phosphorylation decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 1 with image from García-Poyatos et al., 2024
heart mitochondrial crista decreased width, abnormal cox7a1brn6/brn6 standard conditions Fig. 2 with image from García-Poyatos et al., 2024
skeletal muscle extracellular matrix assembly decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
quinol-cytochrome-c reductase activity increased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
heart methionine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
skeletal muscle UDP-D-glucose decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle fructose 6-phosphate decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart methionine increased amount, abnormal cox7a1brn6/brn6 amputation: cardiac ventricle Fig. 6 with image from García-Poyatos et al., 2024
cardiac ventricle regenerating tissue ab1-n2.261 labeling increased amount, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
skeletal muscle methionine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart mitotic cell cycle phase transition decreased process quality, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
heart glycine increased amount, abnormal cox7a1brn6/brn6 amputation: cardiac ventricle Fig. 6 with image from García-Poyatos et al., 2024
heart positive regulation of vasculature development decreased process quality, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
skeletal muscle histidine decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart cellular response to oxidative stress decreased process quality, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
cardiac ventricle regenerating tissue ab1-mef2 labeling increased amount, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
whole organism mitochondrion Ab2-ndufs3 labeling decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 1 with image from García-Poyatos et al., 2024
calcium-mediated signaling increased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
skeletal muscle mitochondrial crista decreased width, abnormal cox7a1brn6/brn6 standard conditions Fig. 2 with image from García-Poyatos et al., 2024
skeletal muscle isoleucine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle lysine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart positive regulation of cell projection organization decreased process quality, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
whole organism decreased weight, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
skeletal muscle ATP decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle D-glucose 6-phosphate decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle leucine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
NADH dehydrogenase (ubiquinone) activity increased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
heart calcium cation increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 2 with image from García-Poyatos et al., 2024
pyruvate metabolic process decreased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart glycerophosphocholine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
carbohydrate catabolic process decreased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle decreased width, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
skeletal muscle glycine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle N-phosphocreatine decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart valine increased amount, abnormal cox7a1brn6/brn6 amputation: cardiac ventricle Fig. 6 with image from García-Poyatos et al., 2024
tricarboxylic acid cycle decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
response to nutrient decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart formate increased amount, abnormal cox7a1brn6/brn6 amputation: cardiac ventricle Fig. 6 with image from García-Poyatos et al., 2024
heart mitochondrial chromosome decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 2 with image from García-Poyatos et al., 2024
heart skeletal muscle decreased mass, abnormal cox7a1brn6/brn6 standard conditions Fig. 5 with image from García-Poyatos et al., 2024
fatty acid oxidation decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
skeletal muscle glycoprotein decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle sarcomere decreased thickness, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with imageFig. 5 with image from García-Poyatos et al., 2024
skeletal muscle polysaccharide decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
heart phosphocholine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
skeletal muscle lactate decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
glycolytic process decreased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle tyrosine decreased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
skeletal muscle valine increased amount, abnormal cox7a1brn6/brn6 standard conditions Fig. 4 with image from García-Poyatos et al., 2024
cytochrome-c oxidase activity decreased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 6 with image from García-Poyatos et al., 2024
muscle contraction increased occurrence, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
regenerating tissue connective tissue replacement involved in inflammatory response wound healing decreased occurrence, abnormal cox7a1brn6/brn6 cryoablation: cardiac ventricle Fig. 7 with image from García-Poyatos et al., 2024
skeletal muscle sarcomere disorganized, abnormal cox7a1brn6/brn6 standard conditions Fig. 5 with image from García-Poyatos et al., 2024
mitochondrial calcium ion transmembrane transport decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 5 with image from García-Poyatos et al., 2024
actin filament organization decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 5 with image from García-Poyatos et al., 2024
skeletal muscle mitochondrial respirasome assembly decreased process quality, abnormal cox7a1brn6/brn6 standard conditions Fig. 3 with image from García-Poyatos et al., 2024
Citations