CRISPR

CRISPR1-jak3

ID
ZDB-CRISPR-231214-3
Name
CRISPR1-jak3
Previous Names
None
Target
Sequence
5' - GGAGATTTGACTCATCAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mdu10 jak3
mdu9 jak3
zf3747 jak3
Expression
Gene expression in Wild Types + CRISPR1-jak3
No data available
Phenotype
Phenotype resulting from CRISPR1-jak3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-jak3
Phenotype Fish Conditions Figures
kidney leukocyte infiltrative, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
blood lymphocyte decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
kidney neoplastic, invasive, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
kidney nkl.4 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
whole organism cd8a expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 3 with image from Basheer et al., 2022
kidney mpx expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
thymus trac expression decreased distribution, abnormal jak3mdu9/mdu9 standard conditions Figure 2 with image from Basheer et al., 2022
brain leukocyte infiltrative, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
whole organism ighv1-1 expression absent, abnormal jak3mdu9/mdu9 standard conditions Fig. S2,  Figure 3 with image from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 2 with image from Basheer et al., 2022
kidney ighm expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
kidney lmo2 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
intestine neoplastic, invasive, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
kidney ighd expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
brain neoplastic, invasive, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
whole organism cd4-1 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 3 with image from Basheer et al., 2022
thymus trac expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 2 with image from Basheer et al., 2022
kidney cd8a expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
whole organism ighv4-6 expression absent, abnormal jak3mdu9/mdu9 standard conditions Fig. S2 from Basheer et al., 2022
kidney myeloid cell decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
thymus rag1 expression decreased distribution, abnormal jak3mdu9/mdu9 standard conditions Figure 2 with image from Basheer et al., 2022
blood neutrophil increased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
liver leukocyte infiltrative, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
liver neoplastic, invasive, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
kidney trac expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
kidney cd4-1 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
thymus ikzf1 expression decreased distribution, abnormal jak3mdu9/mdu9 standard conditions Figure 2 with image from Basheer et al., 2022
thymus ikzf1 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 2 with image from Basheer et al., 2022
intestine leukocyte infiltrative, abnormal jak3mdu9/mdu9 standard conditions Figure 5 with image from Basheer et al., 2022
kidney nccrp1 expression decreased amount, abnormal jak3mdu9/mdu9 standard conditions Figure 4 with image from Basheer et al., 2022
thymus rag1 expression decreased distribution, abnormal jak3mdu10/mdu10 standard conditions Fig. S2 from Basheer et al., 2022
whole organism semi-lethal (sensu genetics), abnormal jak3zf3747/zf3747 standard conditions Fig. 3 with image from Basheer et al., 2022
kidney hematopoietic stem cell increased amount, abnormal jak3zf3747/zf3747 standard conditions Fig. 3 with image from Basheer et al., 2022
whole organism cd4-1 expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 3 with image from Basheer et al., 2022
thymus rag1 expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 2 with image,  Fig. 4 with image from Basheer et al., 2022
lymphocyte increased amount, abnormal jak3zf3747/zf3747 standard conditions Fig. 2 with image from Basheer et al., 2022
kidney lymphocyte increased amount, abnormal jak3zf3747/zf3747 standard conditions Fig. 3 with image from Basheer et al., 2022
blood lymphocyte increased amount, abnormal jak3zf3747/zf3747 standard conditions Fig. 3 with image from Basheer et al., 2022
whole organism trac expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 3 with image from Basheer et al., 2022
whole organism nccrp1 expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 3 with image from Basheer et al., 2022
whole organism cd8a expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 3 with image from Basheer et al., 2022
thymus lck expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 2 with image from Basheer et al., 2022
whole organism nkl.4 expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 3 with image from Basheer et al., 2022
whole organism rag1 expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 3 with image from Basheer et al., 2022
thymus trac expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 2 with image from Basheer et al., 2022
thymus ikzf1 expression increased amount, abnormal jak3zf3747/zf3747 control Fig. 2 with image from Basheer et al., 2022
kidney hematopoietic stem cell increased amount, abnormal jak3zf3747/+ standard conditions Fig. 3 with image from Basheer et al., 2022
thymus rag1 expression increased amount, abnormal jak3zf3747/+ control Fig. 2 with image,  Fig. 4 with image from Basheer et al., 2022
lymphocyte increased amount, abnormal jak3zf3747/+ standard conditions Fig. 2 with image from Basheer et al., 2022
kidney lymphocyte increased amount, abnormal jak3zf3747/+ standard conditions Fig. 3 with image from Basheer et al., 2022
blood lymphocyte increased amount, abnormal jak3zf3747/+ standard conditions Fig. 3 with image from Basheer et al., 2022
thymus lck expression increased amount, abnormal jak3zf3747/+ control Fig. 2 with image from Basheer et al., 2022
whole organism cd8a expression increased amount, abnormal jak3zf3747/+ control Fig. 3 with image from Basheer et al., 2022
whole organism nccrp1 expression increased amount, abnormal jak3zf3747/+ control Fig. 3 with image from Basheer et al., 2022
thymus trac expression increased amount, abnormal jak3zf3747/+ control Fig. 2 with image from Basheer et al., 2022
thymus ikzf1 expression increased amount, abnormal jak3zf3747/+ control Fig. 2 with image from Basheer et al., 2022
whole organism rag1 expression increased amount, abnormal jak3zf3747/+ control Fig. 3 with image from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal il2rgamdu2/mdu2; jak3zf3747/+ control Fig. 4 with image from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal il2rgamdu2/mdu2; jak3zf3747/zf3747 control Fig. 4 with image from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal jak3zf3747/+; jak1zf3761/zf3761 control Fig. 4 with image from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal jak3zf3747/zf3747; jak1zf3761/zf3761 control Fig. 4 with image from Basheer et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.