CRISPR

CRISPR1-rlbp1a

ID

ZDB-CRISPR-230803-2

Name

CRISPR1-rlbp1a

Previous Names

None

Target

rlbp1a (1)

Sequence

5' - GGCAGGCCAAGGAGATGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zh8	rlbp1a

Expression

Gene expression in Wild Types + CRISPR1-rlbp1a

No data available

Phenotype

Phenotype resulting from CRISPR1-rlbp1a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-rlbp1a

Phenotype	Fish	Conditions	Figures
photoreceptor outer segment layer retinal rod cell decreased amount, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 5 from Schlegel et al., 2021
eye rlbp1a expression decreased amount, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 1 from Schlegel et al., 2021
ON-bipolar cell response to light intensity decreased process quality, abnormal	rlbp1a^zh8/zh8	low light intensity, high light intensity	Figure 3 , Figure 4 from Schlegel et al., 2021
retinal pigmented epithelium malformed, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 1 from Schlegel et al., 2021
Muller cell ab1-rlbp labeling decreased amount, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 1 from Schlegel et al., 2021
photoreceptor outer segment layer malformed, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 1 from Schlegel et al., 2021
retina ventral region lesioned, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 5 from Schlegel et al., 2021
retina lipid droplet formation increased occurrence, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 5 from Schlegel et al., 2021
retinal outer nuclear layer decreased thickness, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 5 from Schlegel et al., 2021
retina rho expression decreased amount, abnormal	rlbp1a^zh8/zh8	standard conditions	Figure 6 from Schlegel et al., 2021
retinoid metabolic process decreased process quality, abnormal	rlbp1a^zh8/zh8	low light intensity, high light intensity	Figure 2 from Schlegel et al., 2021
retina rho expression amount, ameliorated	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 6 from Schlegel et al., 2021
Muller cell ab1-rlbp labeling decreased amount, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 1 from Schlegel et al., 2021
retina ventral region lesioned, ameliorated	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 7 from Schlegel et al., 2021
retinal outer nuclear layer decreased thickness, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 7 from Schlegel et al., 2021
retinal outer nuclear layer decreased thickness, ameliorated	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 7 from Schlegel et al., 2021
retina ventral region lesioned, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 7 from Schlegel et al., 2021
retinal pigmented epithelium ab1-rlbp labeling decreased amount, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 1 from Schlegel et al., 2021
ON-bipolar cell response to light intensity decreased process quality, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	low light intensity, high light intensity	Figure 3 , Figure 4 from Schlegel et al., 2021
retinoid metabolic process decreased process quality, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	low light intensity, high light intensity	Figure 2 from Schlegel et al., 2021
retina lipid droplet formation increased occurrence, abnormal	rlbp1a^zh8/zh8; rlbp1b^zh9/zh9	standard conditions	Figure 7 from Schlegel et al., 2021

Citations