CRISPR

CRISPR1-tulp3

ID

ZDB-CRISPR-230316-1

Name

CRISPR1-tulp3

Previous Names

None

Target

tulp3 (1)

Sequence

5' - GGGTTCAGAAGCTCCTGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uf3	tulp3

Expression

Gene expression in Wild Types + CRISPR1-tulp3

No data available

Phenotype

Phenotype resulting from CRISPR1-tulp3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tulp3

Phenotype	Fish	Conditions	Figures
liver fibrotic, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 6 from Epting et al., 2025
ventral cerebrospinal fluid contacting neuron urp1 expression decreased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 3 from Epting et al., 2025
Kupffer's vesicle 9+2 motile cilium decreased length, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 4 from Epting et al., 2025
liver gc expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 6 from Epting et al., 2025
pancreas mislocalised, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 2 from Epting et al., 2025
whole organism curved ventral, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 2 from Epting et al., 2025
Kupffer's vesicle 9+2 motile cilium decreased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 4 from Epting et al., 2025
whole organism jak1 expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 5 from Epting et al., 2025
whole organism acta2 expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 6 from Epting et al., 2025
positive regulation of receptor signaling pathway via JAK-STAT increased occurrence, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 5 from Epting et al., 2025
whole organism serpina1 expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 6 from Epting et al., 2025
Wnt signaling pathway increased occurrence, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 5 from Epting et al., 2025
whole organism lef1 expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 5 from Epting et al., 2025
whole organism hand2 expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 6 from Epting et al., 2025
whole organism urp1 expression decreased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 3 from Epting et al., 2025
vertebral column curved, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 3 from Epting et al., 2025
left/right pattern formation disrupted, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 2 from Epting et al., 2025
whole organism wnt8a expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 5 from Epting et al., 2025
whole organism stat1b expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 5 from Epting et al., 2025
pronephros cystic, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 2 from Epting et al., 2025
liver serpina1 expression increased amount, abnormal	tulp3^uf3/uf3	standard conditions	Fig. 6 from Epting et al., 2025
renal tubule cystic, abnormal	tulp3^uf3/uf3; li1Tg (AB/TL)	standard conditions	Fig. 3 from Devane et al., 2022
hepatocyte cytoplasm transparent, abnormal	tulp3^uf3/uf3; li1Tg (AB/TL)	standard conditions	Fig. 3 from Devane et al., 2022
whole organism tulp3 expression decreased amount, abnormal	tulp3^uf3/uf3; li1Tg (AB/TL)	standard conditions	Fig. 3 from Devane et al., 2022

Citations